Science Procurement
Scientific Equipment and Services Procurement Plans
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR28712491 | Monoblock | Asus ExpertCenter P400 AiO P470VAK-BPE0490, Core i7-13620H/16GB/1TB/UHD Graphics/LAN/W11H | Purchase of a monoblock for the material and technical base | 700000 | 6 | 4200000 | 100% | В период поставки | ||
| BR28712491 | Laptop | Asus P3605CVA Laptop, Core i7 13620H-2.4 GHz/16"/32GB/2TB/UHD Graphics/W11H | Equipment is necessary to implement the project. | 700000 | 2 | 1400000 | 50/50% | В период поставки | ||
| BR28712491 | "Special interactive panels/tables for museums" | Special interactive panels/tables for museums (Hologram) - 3D display "Round" resolution p1.3 internal, - 3D holographic fan 200*100 cm including delivery and installation | Equipment is necessary to implement the project. | 4000000 | 2 | 8000000 | 50/50% | В период поставки | ||
| BR28712491 | LED screens and media facades | 1. LED screens and media facades - 1 indoor P2.5 LED screen, 27.5 sq.m., size 5 x 2.5 m - 1 pc., 5 x 1.5 m - 1 pc., 1.5 x 2.5 m - 2 pcs., including delivery and installation of 1 pc. 2. LED screens and media facades No. 2 - 1 indoor P2.5 LED screen, 20 sq.m., size 5 x 2.5 m - 1 pc., 5 x 1.5 m - 1 pc., including delivery and installation of 1 pc. | Equipment is necessary to implement the project. | 10000000 | 2 | 20000000 | - | 50/50% | В период поставки | |
| BR28712491 | AR/VR (headsets for MR/VR fields) | AR/VR (MR/VR-field headsets) - Meta Quest 3 virtual reality glasses, including delivery | Equipment is necessary to implement the project. | 400000 | 5 | 2000000 | 50/50% | В период поставки | ||
| BR28712491 | "Holographic displays and holographic systems" | Displays and holographic systems" Golo " - 144×81 cm internal Composite display-column, including manufacturing and installation | Equipment is necessary to implement the project. | 600000 | 5 | 3000000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP25794135 | ion meter ITAN | pH Range: 0.00 – 14.00; resolution: ±0.01–0.1 pH TDS Range: 0 – 10,000 ppm (or higher); depending on sensor Temperature (optional) 0 – 100°C Type: portable or built-in (online sensor) Electrodes: industrial pH electrodes and graphite/platinum TDS electrodes Housing material: resistant to acids and alkalis (PVC, PVDF, glass, stainless steel) Protection rating: IP65–IP68 (moisture resistance for sensors) Interface/Output: LCD display, RS232/RS485 capability, 4–20 mA signal, MODBUS | pH meter/ion meter ITAN are used to control and maintain optimal conditions for the growth and vital activity of microorganisms involved in biological processes. An ion meter measures the total amount of dissolved solids (mineralization), and a pH meter measures the acidity of the medium. These parameters are important for the efficient functioning of the bioreactor. | 761600 | 1 | 761600 | 100% | В период поставки | ||
| AP25794135 | i3 UV-VIS scanning spectrophotometer | Elemental composition: Qualitative and quantitative analysis of elements from Na (Z=11) to U (Z=92) Concentration range: from ppb (ng/mL) to % Detection limit (LOD): from 0.1 to 10 ng (depending on the element) Sample weight: 5–10 µL of solution or <1 mg of dry residue Number of elements: up to 30 simultaneously Analysis time: ~3–10 minutes per sample. | The i3 UV-VIS scanning spectrophotometer can be used to analyze the composition and concentration of elements in biomass obtained during anaerobic fermentation. In the context of an anaerobic fermentation bioreactor, this can serve several purposes: monitoring substrate composition, assessing biomass quality, process control, and analyzing fermentation products. Therefore, using the i3 UV-VIS spectrophotometer in an anaerobic fermentation bioreactor provides important data for process optimization and increased production efficiency. | 1050000 | 1 | 1050000 | - | 70/30% | В период поставки | |
| AP25794135 | materials for chemical analysis | 1. Volumetric flasks 100 ml, 250 ml – 10 pcs 2. Volumetric pipettes – 10 pcs 3. Measuring cylinders – 4 pcs 4. Conical flask KN-3-100 with TС scale, neck 22 – 2 pcs 5. Low laboratory beaker H1-50 ml, 100 ml with graduations, TCS – 4 pcs 6. Ashless filters, blue band, D=18.0 cm, pack of 100 – 2 packs 7. Sample container 120 ml, 250 ml sterile – 6 pcs 8. Microcentrifuge tube 0.5 ml, 1.5 ml, 2 ml – 3 pcs 9. Laboratory funnel – 3 pcs 10. Complete PPE set (nitrile gloves – 50 pcs, acid/nitrile resistant, goggles, mask, apron) – 2 sets | Having a basic set of measuring equipment and consumables is a mandatory minimum requirement for obtaining reliable empirical data. This data serves as the basis for creating a universal mathematical model that allows for predicting biogas yield and quality depending on the feedstock composition and process parameters, which is the primary goal of the project. Without this equipment, the experimental portion of the project is impossible. | 159080 | 1 | 159080 | - | 100% | В период поставки | |
| AP25794135 | Acids, alkalis for chemical analysis | 1. Nitric acid (HNO₃), conc., ρ=1.40 g/cm³ – 4.2 kg 2. Hydrochloric acid (HCl), conc., ρ=1.19 g/cm³ – 2.4 kg 3. Ascorbic acid – 100 g 4. Potassium hydroxide (KOH) – 500 g 5. Sodium hydroxide (NaOH) – 1 kg 6. Citric acid – 500 g 7. Hydroxylamine hydrochloride – 100 g | The acquisition of highly concentrated acids and alkalis is mandatory for the full cycle of analytical work within the project. These reagents are considered consumables and are used at critical stages of sample preparation and quantitative chemical analysis. | 42280 | 1 | 42280 | - | 100% | В период поставки | |
| AP25794135 | Reagents, alcohols and buffer solutions for chemical analysis | 1. Hydrogen peroxide 37%, technical – 1.1 kg 2. Potassium iodide, AR – 0.1 kg 3. Sodium salicylate, AR – 1 kg 4. Potassium rhodanide, AR – 0.1 kg 5. Tin(II) chloride dihydrate, AR – 0.1 kg 6. Buffer solution pH – 2 pcs 7. Trilon B, AR – 0.5 kg 8. Sodium citrate tribasic dihydrate, AR – 0.5 kg 9. Hydroxylamine hydrochloride, AR | These reagents and solutions are necessary for specific quantitative analyses, without which it is impossible to obtain primary data on key parameters of the anaerobic digestion process. These parameters serve as direct input for the calibration and verification of the mathematical model being developed. | 135805 | 1 | 135805 | 100% | В период поставки | ||
| AP25794135 | State Standard Samples (SSS) | Standard samples (CRMs) of each determined element with a concentration of 1.0 mg/cm³ | Without using of certified reference materials, all elemental analysis data will be nothing more than estimates, rendering the developed mathematical model incorrect and lacking predictive power. Certified reference materials are a benchmark that provides the necessary level of confidence in the empirical data, which forms the basis for the entire subsequent analytical and modeling system of the project. | 43200 | 1 | 43200 | 100% | В период поставки | ||
| AP25794135 | Laboratory mini centrifuge (7000 rpm) | The mini centrifuge is compact and easy to use, equipped with a durable and transparent polycarbonate lid, resistant to UV. It comes with 2 rotors and adapters for them, allowing placement of 6 x 0.5 ml, 1.5 ml, or 2.0 ml tubes, as well as 16 PCR tubes of 0.2 ml (2 strips of 8 tubes each). The DC motor accelerates the rotor to the set speed with low vibration and operates quietly at less than 45 dB. It guarantees stable operation and high speed accuracy. For user safety, an electronic brake immediately stops the device when the lid is opened. | Equipment is necessary to implement the project. | 160700 | 1 | 160700 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26195367 | Hot-rolled sheet, 5 mm | Hot-rolled steel sheet is a high-quality rolled metal product manufactured from steel blanks using high-temperature heating (up to 1400°C) and subsequent rolling on specialized mills. This process results in the metal achieving physical and chemical homogeneity and superior performance characteristics. Hot-rolled steel sheet 5 mm (metal cutting), steel grade st3sp5, 5x1400x6000 mm | Material is necessary to implement the project. | 460000 | 3 | 1380000 | - | 50/50% | В период поставки | |
| AP26195367 | Hot-rolled sheet, 3 mm | Hot-rolled steel sheet is a high-quality rolled metal product manufactured from steel blanks using high-temperature heating (up to 1400°C) and subsequent rolling on specialized mills. This process results in the metal achieving physical and chemical homogeneity and superior performance characteristics. Hot-rolled steel sheet 3 mm (metal cutting), steel grade st3sp5, 3x1400x6000 mm | Material is necessary to implement the project. | 460000 | 3 | 1380000 | - | 50/50% | В период поставки | |
| AP26195367 | 20x20x3 mm square steel profile tube | A 20x20x3 mm square steel profile tube is a type of rolled metal product manufactured from carbon structural steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. Cold or hot deformation is used in the manufacturing process, ensuring precise cross-sectional geometry and high strength. This product is a square steel tube with a cross-sectional dimension of 20x20 mm and a wall thickness of 3 mm. It is available in lengths from 6 to 12 meters, weighing approximately 1.42 kg per linear meter. It is manufactured in accordance with GOST 30245-2003 or GOST 8639-82. | Material is necessary to implement the project. | 520 | 1000 | 520000 | - | 50/50% | В период поставки | |
| AP26195367 | 50x30x3 mm square steel profile tub | A 50x30x3 mm square steel profile tube is a rolled metal product manufactured from structural carbon steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. The production process includes hot or cold deformation, ensuring precise profile geometry, structural homogeneity, and high strength properties of the metal. This product is a rectangular steel profile tube measuring 50x30 mm and a wall thickness of 3 mm. The standard length of the tube is 6–12 m, and the weight per linear meter is approximately 3.26 kg. Manufacturing is carried out in accordance with GOST 30245-2003 or GOST 8639-82. This profile tube is characterized by increased rigidity, bending resistance, and ease of welding and installation. It is used in the construction of metal structures, in the manufacture of supports, frames of buildings and structures, furniture elements and mechanical engineering. | Material is necessary to implement the project. | 520 | 1200 | 624000 | - | 50/50% | В период поставки | |
| AP26195367 | Anti-corrosion paint for metal | Anti-corrosion paint for metal is a specialized paint coating designed to protect metal surfaces from moisture, chemicals, and mechanical damage. It is made from alkyd, epoxy, acrylic, or polyurethane resins with the addition of corrosion inhibitors and anti-corrosion pigments. During application, the paint forms a dense protective film that prevents oxygen and moisture from penetrating the metal surface, thereby significantly extending the service life of structures. It can be used as a stand-alone coating or as part of a multi-layer system (primer + enamel). The product is used for painting metal components, pipelines, frames, supports, and machine and equipment components operating in various climatic conditions. It features high adhesion, UV resistance, and resistance to temperature fluctuations. The mass fraction of non-volatile substances is 60%-65%. Conventional viscosity according to a VZ-245 viscometer with a 4 mm nozzle diameter at a temperature of (20 ± 2) °C 80-160 s Consumption per single-layer coating, g/m2 200 Drying time to degree 3 at a temperature of (20 ± 2) °C and a relative humidity of (60 ± 5)% 30 minutes, no more | Material is necessary to implement the project. | 2500 | 100 | 250000 | - | 50/50% | В период поставки | |
| AP26195367 | Raspberry pi microcontroller | The Raspberry Pi Pico is a tiny, fast, and versatile board built using the RP2040, a completely new microcontroller. The Raspberry Pi RP2040 features a dual-core Arm Cortex-M0+ processor with 264 KB of onboard RAM and support for up to 16 MB of external flash memory. Flexible I/O options include I2C, SPI, and a unique programmable I/O (PIO). | Equipment is necessary to implement the project. | 12000 | 10 | 120000 | - | 50/50% | В период поставки | |
| AP26195367 | CNC laser cutting machine | 1500W fiber laser. Laser working material: YVO4. Laser wavelength: 1170nm. X-axis travel: 1500mm. Y-axis travel: 3000mm. Z-axis travel: 120mm. Effective cutting range: 3000×1500mm. Positioning accuracy of the working table along the axis: ≤±0.03mm/m. Repeatability of the working table: ≤±0.03mm/m. Maximum positioning speed: 120m/min. Maximum loading capacity of the working table: ≥800kg. Number of phases: 3. Rated supply voltage: 380V, 3 phases, frequency: 50Hz. Power supply protection rating: IP54 Maximum cutting thickness: Carbon steel 12 mm, Stainless steel 6 mm, Aluminum alloy 2 mm, Brass 2 mm. Compressed air supply system (one receiver and refrigerated dryer recommended): Volume: 1 m³, Nominal pressure: 1.5 MPa, Air consumption: 1 l/min. Nominal output voltage: 380 V/50 Hz. Voltage stability: +5%. Auxiliary gas purity requirements for cutting: Oxygen (O2) ≥99.95%, Nitrogen (N2) ≥99.99%. | Equipment is necessary to implement the project. | 5000000 | 1 | 5000000 | - | 50/50% | В период поставки | |
| AP26195367 | Laser welding machine | Power supply 1 (one 3000W). Generator 1 (one cap) Cold water laser unit (1 pc.) Sheet metal (housing) (1 pc.) Gun holder (1 set) Protective lens (5 pcs.) Equipment acceptance certificate (1 pc.) Pulse power supply (1 pc.) Power supply for oscillating motor (1 pc.) Copper head (8 pcs.) Silk feeder (1 set) Fiber optic cable (1 pc.) Twig 10 meters 3-in-1 functions: Welding, Cleaning, Cutting Power: 3000 W Laser wavelength: 1080 + 10 m Operating mode: Continuous/Modulation Power adjustment range: 10–100% Pointing and location: Red light Optic cable length: 10 m Welding speed: 0–120 mm/s Wire feed speed (standard): 38–600 m/min Wire diameter: 0.8/1.0/1.2/1.6/2.0 mm Cooling method: Water Power supply: 380 VAC/50 Hz Auxiliary gas: Argon/Nitrogen External dimensions: 1120×550×1210 mm Weight: ≈150 kg | Equipment is necessary to implement the project. | 3967060 | 1 | 3967060 | - | 50/50% | В период поставки | |
| AP26195367 | 500kN hydraulic press brake | 1. Nominal pressure: 300 kN. 2. Table length: 1600 mm. 3. Distance between bodies: 1280 mm. 4. Neck depth: 190 mm. 5. Ram stroke: 80 mm. 6. Height in open position: 300 mm. 7. Overall dimensions: Length (L): 1860 mm. Width (W): 1700 mm. Height (H): 2000 mm. 8. Main motor power: 4 kW. Electrical control system: the machine uses a three-phase, four-wire power supply, 50 Hz, 380 V. The machine motor is powered by three-phase 380 V, and the lamps are powered by single-phase 220 V. The control transformer is powered by two-phase 380 V. The output of the control transformer provides power to the control circuit: 24 V - for controlling the back stop and the electromagnetic valve. 6V is for indicator lamps and 24V is for other control components. | Equipment is necessary to implement the project. | 6500000 | 1 | 6500000 | - | 50/50% | В период поставки | |
| AP26195367 | CNC plasma cutting machine | Lateral span: 2200 mm. Effective cutting width: 1600 mm. Length of longitudinal guides (surface roughness of guides Ra≤3.2 μm): 3500 mm. Effective cutting length: 3000 mm. Torch lifting height: 0–120 mm. Cutting speed: 0–6000 mm/min. Cut surface roughness: 12.5 μm ≤Ra≤25 μm. Control system: Shanghai Fangling F2100B. Plasma system power source: Junke CNC 120A. Lifting mechanism: one set. Number of control axes: 2-axis linkage (3- or 4-axis adjustable). Control accuracy: ±0.001 mm. Coordinate range: ±99999.99 mm. Maximum pulse frequency: 200 kHz; The maximum working speed is 15 meters per minute. The maximum number of program lines is 150,000 lines. The maximum size of a single program is 4 million. Time resolution is 10 ms. System power supply is +24 VDC, the power is more than 80 watts. The system operating environment is: temperature from -10 ℃ to +60 ℃; relative humidity is 0-95% without condensation. Includes 48 commonly used graphic libraries (including mesh graphics), with the ability to select sheet size and hole size. | Equipment is necessary to implement the project. | 2483786 | 1 | 2483786 | - | 50/50% | В период поставки | |
| AP26195367 | Three-axis bending machine for profiles and pipes | 3 kW engine, BWD-59-3KW gear motor, diameter within 50 mm, weight 400 kg, dimensions 800*800*1200 mm (L*W*H). | Equipment is necessary to implement the project. | 1761717 | 1 | 1761717 | - | 50/50% | В период поставки | |
| AP26195367 | 60×40×3 mm square steel profile tube | A 60×40×3 mm square steel profile tube is a rolled metal product manufactured from structural carbon steel (grades St3sp, St3ps, or 09G2S) using longitudinal electric welding. The manufacturing process includes hot or cold deformation, ensuring precise profile geometry, a uniform metal structure, and high performance characteristics. The product has a rectangular cross-section of 60×40 mm and a wall thickness of 3 mm. The standard tube length is 6–12 m, and the weight per linear meter is approximately 4.08 kg. Production is carried out in accordance with the requirements of GOST 30245-2003 or GOST 8639-82. The tube is characterized by high strength, bending resistance, and ease of welding and machining. It is used in the production of metal structures, load-bearing frames, fences, supports, as well as in mechanical engineering and construction. | Material is necessary to implement the project. | 520 | 1500 | 780000 | - | 50/50% | В период поставки | |
| AP26195367 | Tool kit | The Universal Tool Set (80-piece kit) is a multifunctional set of hand-held plumbing and assembly tools designed for assembly, repair, and technical work in both domestic and professional settings. All components are made of durable alloy steel with an anti-corrosion coating, ensuring durability and reliability. The set includes: • Hammer — 1; • Pliers — 1; • Ratchet wrenches — 2; • Combination wrenches (sizes 10, 11, 12, 13, 14, 15, 17, 19) — 8; • Pliers — 1; • SL, PH screwdrivers — 5; • Screwdriver holder — 1; • Extension — 3; • Cardan — 2; • Spark plug sockets (16, 21 mm) — 2; • Adapter — 1 pc; • Sockets (4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 19, 22, 24, 27, 30, 32 mm) — 23 pcs; • Extended sockets (5, 6, 7, 8, 9 mm) — 5 pcs; • Hexagon socket wrenches — 6 pcs; • Bit adapter — 1 pc; • T, SL, PH insert bits — 14 pcs; • Plastic storage and carrying case — 1 pc; • Ratchet — 1 pc. All tools are housed in a durable plastic case for easy transport and storage. | Equipment is necessary to implement the project. | 83860 | 2 | 167720 | - | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26100207 | Densitometer | Measurement range from 0 g/cm3 to 3 g/cm3 Resolution ±0.0001 g/cm3 Repeatability ±0.0001 g/cm3 Accuracy ±0.0003 g/cm3 Injection method Automatic (compatible with manual) Yes Video Yes Temperature control method Peltier Temperature control range 5^∘ C-45^∘ C Temperature control stability ±0.02 ^∘ C Display method 10.4-inch color touch screen FTP Data storage 32G Output method USB, RS232, RJ45, SD-card, U-disk User management Yes / four levels of authority management Audit Trail Yes Electronic Signature Yes User method library Yes Export file for high-level verification MD5 protection Yes Wi-Fi printing Yes Export to multiple file formats PDF and Excel Size 480^* 320^* 200 mm Power supply 110-230 V, 50 Hz/60 Hz. Weight 8 kg | Equipment is necessary to implement | 4600000 | 1 | 4600000 | november | 50/50% | В период поставки | |
| AP26100207 | Multi-position magnetic stirrer | Power (W): 3600, Display mode: LCD display, Speed range (rpm): 100-1500, Maximum volume of H2O for stirring (L): 5^* 4, Time range: 1 ~ 99 hours 59 minutes, Temperature control range (°C): RT-330, Working size (mm): ϕ150, Motor type: Brushless DC motor, Country of origin: China. | Equipment is necessary to implement | 1100000 | 1 | 1100000 | november | 50/50% | В период поставки | |
| AP26100207 | Ansys Academic Research Mechanical and CFD | A software suite for computer modeling and analysis of various physical processes using the finite element method. It enables simulations such as strength analysis, fluid dynamics, heat transfer, electromagnetic calculations, and signal integrity analysis, and covers a wide range of engineering and physics problems. | Equipment is necessary to implement | 11834144 | 1 | 11834144 | november | 50/50% | В период поставки | |
| AP26100207 | Monoblock | Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/8GB/512GB/UHD Graphics/W11SL | Equipment is necessary to implement | 400000 | 9 | 3600000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26196803 | Raw material | Horse meat 300kg*3700=1110000 Sunflower oil 50L*1000=50000 Rapeseed oil 50L*1250=62500Linseed oil 25L*5000=125000 Margarine 5kg*1500=7500 | Equipment is necessary to implement | 1355000 | 1 | 1355000 | - | 100% | В период поставки | |
| AP26196803 | Reagents | Hydrogen peroxide concentrated 3L*1000=3000 Sulfuric acid concentrated 3kg*2000=6000 Hydrochloric acid concentrated 3kg*1600=4800 Diethyl ether 3L*9500=28500 Reagents for Karl Fischer titration 4pcs*122000=48800 | Equipment is necessary to implement | 530300 | 1 | 530300 | - | 100% | В период поставки | |
| AP26196803 | Karl Fischer Automatic Titrator | TitroLine® 7500 KF: volumetric titration, titration to the end point (SO2, bromine number). Delivery set: titrator, replaceable module WA 10, TM 235 KF stand with integrated stirrer and pump, titration vessel TZ 1770, double platinum micro-electrode KF 1100 and start-up kit, power supply 100-240 V. Dosing volume: 10 ml. Dosing accuracy: 0.15 R%. Dimensions (WxDxH) 153 x 296 x 450 mm. Power supply 100 … 240 V, 50/60 Hz. Manufacturer: SI Analytics, Germany. | Equipment is necessary to implement | 7085607 | 1 | 7085607 | 70/30% | В период поставки | ||
| AP26196803 | Water distiller | Electric Water Distiller AE-5. Production of distilled water for laboratory and technological needs. Electric. Capacity: 5 L/h, body and vessels: stainless steel, 220 V, 50/60 Hz. Power: 1.5 kW. Dimensions (WxDxH): 300 x 250 x 450 mm. Weight: 12 kg. Manufacturer: Russia. | Equipment is necessary to implement | 526361 | 1 | 526361 | 50/50% | В период поставки | ||
| AP26196803 | Soxhlet Extraction Apparatus (portable) | Soxhlet Extraction Apparatus, 300 ml, NS 60/466 Duran. Extraction of fats and other soluble components from solid samples in laboratory conditions. Flask volume: 300 ml. Flask material: Duran glass. Connections: NS 60/466. Durable laboratory apparatus, compatible with various solvents, reusable. Weight: 1.2 kg. Manufacturer: Duran. Country of origin: Germany. | Equipment is necessary to implement | 188264 | 1 | 188264 | - | 50/50% | В период поставки | |
| AP26196803 | Scientific research service | Аnalysis of physico-chemical properties of vegetable oils and horsemeat fat | Research within the project | 600000 | 1 | 600000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26198515 | Raw material | 1 beef 100 kg * 4000=400,000 2 horse meat 80 kg * 3800=304000 3 by-products 100 kg * 2500=250,000 4 intestines (beef, horse, mutton) 100 m * 2400 =240000 5 additional meat raw materials 50 kg * 3000 = 150,000 6 chicken soups 50 kg * 500 = 25000 7 Blood 50 L * 450 =22,500 8 liver 50 kg * 2500= 125000 9 vegetables 50 kg * 400=20,000 10 sunflower oil 50L * 900=45000 11 melange 10 kg * 320 = 3,200 | Conducting laboratory work in accordance with the calendar plan | 1627700 | 1 | 1627700 | november | 100% | В период поставки | |
| AP26198515 | Packaging containers | Used to protect products from damage, contamination, and external factors | Necessary for preserving product quality and protecting against external factors (moisture, contamination, microbial impact). | 100 | 200 | 20000 | november | 100% | В период поставки | |
| AP26198515 | Мeat roll molds | They define the shape and volume of the product (loaves, rolls), used for cold/warm forming and resting before heat treatment; facilitate the filling of the mince into casings or trays and ensure a uniform appearance of the product | Тo ensure the correct shape and density of the product | 2300 | 10 | 23000 | november | 100% | В период поставки | |
| AP26198515 | Universal thermal chamber | Comprehensive processing of semi-finished products - cooking (steam/heating), smoking (hot/cold), drying, and curing; provides sterile heat treatment, even heating, humidity control, and/or smoke supply control. Used for boiled, smoked, and semi-smoked sausages. For small workshops, simpler equipment (used or small models) can be selected. When choosing, pay attention to the power of the steam generator, material stainless steel, temperature and humidity control, and smoke generation system | Universal thermal chamber for conducting controlled temperature testing and product processing | 7912000 | 1 | 7912000 | october - november | 50/50% | В наличии | |
| AP26198515 | Тabletop vacuum sealer | Air removal from packaging and airtight sealing – extends shelf life, prevents oxidation and growth of aerobic microorganisms; used for already chilled products, raw materials, and finished loaves before sale. In industry – either chamber vacuum sealers (for whole loaves) or external “bag” models for small batches. Budget brands/options: the market offers industrial and tabletop/portable vacuum sealers; available brands include Hurakan, VIATTO | Vacuum packaging machine for removing air from packaging | 550000 | 1 | 550000 | november | 50/50% | В период поставки | |
| AP26198515 | Сutter HURAKAN HKN-CL35MSW | Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops | The cutter is used to obtain homogeneous and pliable meat mince, improve product texture, and enhance the quality of the finished meat products. | 1733140 | 1 | 1733140 | november | 50/50% | В период поставки | |
| AP26198515 | Сlipper | Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops | The clipper is used for reliable sealing of packaging, ensuring airtightness and preserving product freshness | 180000 | 1 | 180000 | november | 50/50% | В наличии | |
| AP26198515 | laboratory services | Conducting research on chemical, physico-chemical, functional and technological properties and food safety of new natural meat products from additional raw materials. Determination of water activity, determination of pH value, determination of moisture retention capacity (MRC), determination of moisture binding capacity (MBC), determination of fat retention capacity (FRC), determination of chemical composition by the single-sample method, determination of fatty acid composition, determination of color parameters, organoleptic evaluation of meat and meat products, determination of shear force (SF), determination of emulsifying ability, toxicological tests, pesticide analysis, radiological tests. | The study of chemical, physico-chemical, functional and technological properties and food safety indicators of natural meat products from additional raw materials is necessary to assess their quality, nutritional value and technological suitability. Additional meat raw materials differ in composition and structure, which can affect the taste, texture, yield of finished products and resistance to microbiological risks. A comprehensive assessment will make it possible to determine the optimal conditions for its use, ensure safety, improve the quality of final products and use raw materials efficiently. | 400000 | 1 | 400000 | - | 50/50% | В период поставки | |
| AP26198515 | Sticky photo paper | Self-adhesive photo paper has an adhesive layer on the back, allowing printed photos to be easily stuck to various surfaces without additional glue | Equipment is necessary to implement | 2500 | 20 | 50000 | november-december | 100% | В период поставки | |
| AP26198515 | Glossy photo paper | Glossy photo paper has a bright, shiny surface that provides high saturation and sharpness of images | Equipment is necessary to implement | 3500 | 20 | 70000 | november-december | 100% | В период поставки | |
| AP26198515 | A4 paper | A4 paper is a standard paper size (210×297 mm), widely used for printing, copying, and writing. It has good density and a smooth surface, suitable for office and home equipment | Equipment is necessary to implement | 2500 | 4 | 10000 | november-december | 100% | В период поставки | |
| AP26198515 | Monoblock | Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/16GB/512GB/UHD Graphics/W11SL | Equipment is necessary to implement the project. | 500000 | 5 | 2500000 | 50/50% | В период поставки | ||
| AP26198515 | Lenovo Laptop | Lenovo V15 G5 IRL Laptop, Core i7-13620H/15.6" FHD/16GB/512GB/UHD Graphics/LAN/W11H | To perform work remotely | 300000 | 4 | 1200000 | 50/50% | В период поставки | ||
| AP26198515 | laptop | Asus P1503CVA Laptop, Core i5-13420H/15.6" FHD/8GB/512GB/UHD Graphics/LAN/W11H | To perform work remotely | 373 | 1 | 373 | 50/50% | В период поставки | ||
| AP26198515 | MFP (Color) | MFP HP Color LaserJet Pro M182n, A4, print 600x600dpi, 16/16ppm, сканерлеу 1200dpi, USB, LAN | Equipment is necessary to implement the project | 250000 | 1 | 250000 | 50/50% | В период поставки | ||
| AP26198515 | MFP | HP LaserJet M236dw multifunction printer (MFP), A4, print 600×600 dpi, 29 ppm, scan 600×600 dpi, LCD, LAN | Equipment is necessary to implement | 150000 | 1 | 150000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР26197931 | Wind pumping unit | Rotor diameter: up to 2.4 m Blade material / quantity: galvanized steel / 18 pcs Start wind speed: not less than 2.5 m/s Operating wind speed: 6–8 m/s Maximum operating wind speed: up to 40 m/s Nominal stroke rate: up to 32 strokes/min Braking system: manual brake Tower height: up to 12 m Total weight (with tower): up to 400 kg Service life: up to 20 years | Equipment is necessary to implement the project. | 2700000 | 1 | 2700000 | october | 70/30% | В период поставки | |
| АР26197931 | Installation works of the purchased wind-pumping unit. | Installation and commissioning works of the purchased wind-pumping unit above the well. | The service is required for the further implementation of the project. | 1100000 | 1 | 1100000 | october | 70/30% | В период поставки | |
| АР26197931 | Well drilling | Well drilling with a metal casing pipe of 133 mm diameter. The maximum well depth is 24 meters. | The service is required for the further implementation of the project. | 1150000 | 1 | 1150000 | october | 70/30% | В период поставки | |
| АР26197931 | Rental of a flatbed cargo truck. | Rental of a flatbed cargo truck | The service is required for the further implementation of the project. | 670050 | 1 | 670050 | 70/30% | В период поставки | ||
| АР26197931 | Rental of a truck crane. | Rental of a truck crane for lifting and installation works. | The service is required for the further implementation of the project. | 25000 | 4 | 100000 | - | 70/30% | В период поставки | |
| АР26197931 | Steel Pipe | Ø133/4, length 24 m (12х2=24) | Equipment is necessary to implement the project | 6177 | 2 | 12354 | october | 70/30% | В период поставки | |
| АР26197931 | Rental of a truck-mounted crane (manipulator). | Rental of a truck-mounted crane (manipulator) on a flatbed vehicle for installation and loading/unloading operations. | The service is required for the further implementation of the project. | 20000 | 8 | 160000 | october - november | 70/30% | В период поставки | |
| АР26197931 | Bench lathe with pedestal | JET BD-11G Desktop Lathe Turning diameter over cross slide: up to 170 mm Spindle speed: not less than 150 rpm — up to 2000 rpm Number of spindle speeds: 6 Spindle taper: MT-4 Spindle bore diameter: up to 26 mm Longitudinal feed range: 0.07 – 0.4 mm/rev Number of longitudinal feeds: 6 Metric thread range: 0.2 – 3.5 mm Number of metric threads: 21 Inch thread: 8 – 56 TPI Number of inch threads: 21 Leadscrew pitch: Tr 20x3 Max tool size: up to 12 × 12 mm Cross slide travel: up to 145 mm Top slide travel: up to 60 mm Tailstock taper: MT-2 Tailstock quill travel: up to 80 mm Quill diameter: up to 30 mm Fixed steady rest range: up to 25 mm Moving steady rest range: up to 25 mm | Equipment is necessary to implement the project. | 2300000 | 1 | 2300000 | - | 70/30% | В период поставки | |
| АР26197931 | Desktop Drilling Machine with workbench | Power: not less than 750 W Supply voltage: up to 400 V Motor type: asynchronous Spindle speed: not less than 200 rpm — up to 2350 rpm Tool shank diameter: up to 16 mm Belt type: Poly-V 5PJ450 Transmission type: belt Worktable material: cast iron Worktable size (L×W): up to 275 × 245 mm Base size: up to 345 × 520 mm Table tilt angle: up to -45°…+45° Number of spindle speeds: 5 Spindle taper: KM2 Chuck type: keyed Spindle quill travel: up to 96 mm Max distance spindle–table: up to 410 mm Max distance spindle–base: up to 650 mm Base material: cast iron Spindle–column distance: up to 205 mm Laser pointer: yes Lighting: yes Chuck mount: B16 Column diameter: up to 70 mm Fork type: TH-015T Max table load: up to 30 kg Threading function: yes Max drilling diameter in wood: up to 50 mm Power cord length: up to 1.8 m Max drilling diameter in soft metals: up to 20 mm Max drilling diameter in hard metals: up to 18 mm Dimensions (L×W×H): up to 710 × 585 × 1120 mm Packing dimensions (L×W×H): up to 1060 × 610 × 380 mm Net weight: up to 96 kg Gross weight: up to 96 kg Delivery set: 1 pc. Warranty period: 12 months Extended warranty: +24 months Country of origin: China | Equipment is necessary to implement the project. | 1449351 | 1 | 1449351 | - | 70/30% | В период поставки | |
| АР26197931 | VP-E Metal Workbench with | Dimensions (L × W × H): up to 860 × 1000 × 685 mm Maximum load capacity: up to 500 kg Worktop: MDF desktop covered with galvanized sheet metal Included: hanging drawer, two supports Color: blue RAL 5002 and yellow RAL 1003 (can be painted in any RAL color) Construction: metal workbench, double-cabinet (two pedestals) Model code: VP-E | Equipment is necessary to implement the project. | 125000 | 2 | 250000 | 70/30% | В период поставки | ||
| АР26197931 | Receiver (compressed air storage tank) | Vertical Compressed air inlet/outlet: 1/2 inch Overall dimensions (L × W × H): no more than 570 × 560 × 1000 mm Maximum pressure: not less than 10 atm Weight: no more than 65 kg Body material: Steel St3 Receiver volume: not less than 110 L Ambient temperature: from –20 °C to +100 °C | Equipment is necessary to implement the project. | 320000 | 6 | 1920000 | - | 70/30% | В период поставки | |
| АР26197931 | Condensate Trap | Maximum pressure: not less than 16 bar Maximum operating temperature: not less than 200 °C Connection diameter: ½" Flow rate: not less than 30 and not more than 180 kg/h Working medium: Compressed air Connection type: Threaded Body material: Zinc alloy | Equipment is necessary to implement the project. | 66720 | 6 | 400320 | - | 70/30% | В период поставки | |
| АР26197931 | Plastic Water Tank | 3 m³, underground | Equipment is necessary to implement the project. | 480000 | 1 | 480000 | - | 70/30% | В период поставки | |
| АР26197931 | Pneumatic Motor | Motor type: pneumatic rotary Power: up to 2.0 hp (≈ 1.5 kW) Operating pressure: not more than 6.3 bar No-load speed: up to 8,500 rpm Maximum torque: up to 1.5 N·m Air consumption: up to 34 L/s (≈ 2.04 m³/min) Rotation direction: right-hand (R) Weight: up to 1.7 kg Drive type: direct | Equipment is necessary to implement the project | 297000 | 2 | 594000 | 70/30% | В период поставки | ||
| АР26197931 | Compressors | Power: not less than 1.1 kW (≈ 1.5 hp) Operating pressure: not less than 8 bar Maximum pressure: up to 10 bar Tank capacity: not less than 50 L Air delivery rate: not less than 240 L/min Motor type: asynchronous, oil-lubricated Voltage: 220 V / 50 Hz Number of cylinders: 1 Protection: thermal control and auto shut-off Air outlet fitting: 1/4'' Noise level: up to 80 dB Weight: up to 34 kg Dimensions (L×W×H): approx. 780 × 330 × 650 mm Compressor No. 2 - Compressor head 1051 0.75 kW/1HP Voltage: not less than 220 V, 380 V Power source: gasoline Configuration: portable Type: piston Gas type: air Cooling method: air-cooled Sound reduction: no Warranty: not less than 1 year Weight: not less than 35 kg Origin: Zhejiang, China Brand name: MUGE Size (L×W×H): not less than 23×16×23 cm Standard or non-standard: standard Structure: piston pump Use: air compressor pump Power: not less than 0.75 kW Fuel: gasoline Pressure: not less than 8 bar Horsepower: not less than 1 HP Maximum flow rate: not less than 56 | Equipment is necessary to implement the project. | 115049 | 2 | 230098 | - | 70/30% | В период поставки | |
| АР26197931 | Submersible Pump | Type: borehole Design: submersible, multistage Power: ≥ 323 W Frequency: 50 Hz Max head (lifting height): up to 45 m Max submersion depth: up to 50 m Flow rate: ≥ 52.3 L/min Pipe connection: internal thread G1 inch Pump diameter: 80 mm Casing material: stainless steel Water intake position: central Dry-run protection: not included Max liquid temperature: up to 40 °C Min water level: ≥ 789 mm Impeller material: noryl (engineering polymer) For pressure boosting: not intended Connector included: no Cable length: ≥ 20 m Overheat protection: yes Soft start device: no Series: NPCS Rated voltage: 220 V Operating pressure: up to 4.5 bar Min allowable borehole diameter: 100 mm Protection class: IP68 | Equipment is necessary to implement the project. | 69890 | 1 | 69890 | - | 70/30% | В период поставки | |
| АР26197931 | 3D Printer | Bambu Lab X1-Carbon Combo Printing method: FDM (fused deposition modeling) Maximum print speed: 500 mm/s Build (working) volume: 256 × 256 × 256 mm Printer dimensions: 389 × 389 × 457 mm Weight: 22.3 kg Warranty: 12 months Display / control: color display with advanced features Software compatibility: Bambu Studio, Cura, SuperSlicer, etc. Controller system: microcontroller (Cortex-M4) + system part (Cortex-A7 + NPU) Supported materials: PLA, PETG, PA-CF and others Version: EU version, intended for Europe and Kazakhstan — provides access to firmware updates, remote control, etc. | Equipment is necessary to implement the project. | 1300000 | 1 | 1300000 | - | 70/30% | В период поставки | |
| АР26197931 | PLA Plastic | Color available in assortment Material type: thermoplastic polyester (biopolymer) Origin: renewable resources (corn starch, sugarcane, etc.) Melting temperature: 170 – 180 °C Glass transition temperature: ~60 °C Density: 1.23 – 1.25 g/cm³ Tensile strength: ≥ 50 MPa Elongation at break: up to 6 % Hardness (Shore D): ~83 Thermal conductivity: 0.13 W/(m·K) Working temperature: up to 55 °C Moisture absorption: up to 0.4 % Color: various (depending on manufacturer) Key features: biodegradable, eco-friendly, easy to print, no heated bed required in most cases Applications: 3D printing, prototyping, packaging, household items | Equipment is necessary to implement the project | 14500 | 8 | 116000 | 70/30% | В период поставки | ||
| АР26197931 | Solar power station (Solar photovoltaic module) | Panel type: polycrystalline. Nominal power: not less than 300 W. Operating voltage (Vmp): not less than 36 V. Operating current (Imp): not less than 8.3 A. Open-circuit voltage: not less than 43 V. Short-circuit current: not less than 8.8 A. Dimensions: not less than 1640 × 992 × 40 mm. Weight: not less than 18 kg. Temperature coefficient: not less than −0.45 %/°C. Front surface material: not less than tempered glass. Resistance to hail and snow: not less than 5400 Pa pressure. Temperature range: not less than −40°C…+85°C. Service life: not less than 25 years. | Equipment is necessary to implement the project. | 271130 | 2 | 542260 | 70/30% | В период поставки | ||
| АР26197931 | Mounting Brackets for Solar Station | Thickness: 3–5 mm Material: aluminum or steel Mounting angles: 0–30° Protection: anti-corrosion (anodized or galvanized) Load capacity: 50–100 kg per panel Length: 50–200 mm (depending on panel) Bolts and nuts: M6–M8, stainless steel | Equipment is necessary to implement the project | 12000 | 2 | 24000 | - | 70/30% | В период поставки | |
| АР26197931 | Voltmeter | Voltage range: not less than 70 V — up to 500 V Type: AC (single-phase) Display: electronic LED display Measurement accuracy: up to ±1 % Input resistance: not less than 1 MΩ Current consumption: up to 23 mA Update time: up to 300 ms Display color: red / blue / green Dimensions: up to 48 × 29 × 22 mm Mounting hole: up to 46 × 27 mm Weight: up to 18 g Operating temperature: not less than −20 °C and up to +65 °C | Equipment is necessary to implement the project | 14200 | 1 | 14200 | - | 70/30% | В период поставки | |
| АР26197931 | Ammeter | Power supply: from mains, not less than 220 V Type: ammeter Device: electronic Functions: none PC connection: no Display: available Color: white, not less than 90% surface gloss | Equipment is necessary to implement the project. | 5400 | 1 | 5400 | - | 70/30% | В период поставки | |
| АР26197931 | Circuit Breaker | Rated operational voltage – not less than 230 V Rated operational current (In) – not less than 10 A Number of poles – not less than 1 Rated network frequency – not less than 50/60 Hz Maximum breaking capacity – not less than 4.5 kA Current limiting class – not less than 3 Electrical endurance – not less than 6000 cycles Mechanical endurance – not less than 15000 cycles Operating temperature range – from −40°C not less than +50°C Storage temperature range – from −40°C not less than +70°C Terminal protection degree (per GOST 14254-96) – not less than IP20 Pollution degree (per GOST 9920-89) – not less than 2 Max cross-section of connecting conductor – not less than 16 mm² Thermal release characteristic – per GOST R 50345-99 Overall dimensions – not less than 9×73×80 mm Weight – not less than 52 g | Equipment is necessary to implement the project. | 4624 | 2 | 9248 | - | 70/30% | В период поставки | |
| АР26197931 | Installation and mounting of the solar power station | Site preparation, assembly, and installation of the solar power station. | The service is required for the further implementation of the project. | 180000 | 2 | 360000 | - | 70/30% | В период поставки | |
| АР26197931 | Monoblock | Acer Aspire C27-2G Monoblock, 27" FHD, Core i5-13420H/16GB/512GB/ UHD Graphics/W11SL | Equipment is necessary to implement the project | 400000 | 9 | 3600000 | 50/50% | В период поставки | ||
| АР26197931 | Laptop | MSI Katana 15 B14WFK, Core i7-14650HX/15.6"QHD/16GB/1TB/GF RTX5060 8GB/LAN/W11H | Equipment is necessary to implement the project. | 860000 | 1 | 860000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26101621 | Ultrasound system with Doppler imaging | Ultrasound device with doppler, Draminski Blue (complete set with three sensors and additional software for the study of cattle, MRS, Pigs, Horses, small pets), Poland | Equipment is necessary to implement the project. | 30000000 | 1 | 30000000 | 70/30% | В период поставки | ||
| AP26101621 | Veterinary first-aid kit | 45 L thermal case with surgical kit (vet option: with veterinary surgical kit) | Equipment is necessary to implement the project. | 75000 | 4 | 300000 | - | 50/50% | В период поставки | |
| AP26101621 | ELISA kit for bovine LPS (lipopolysaccharide) | Bovine LPS (lipopolysaccharide) ELISA kit, 96 tests, ELK8425 | Reactive is necessary to implement the project. | 302741 | 10 | 3027410 | - | 50/50% | В период поставки | |
| AP26101621 | Monoblock | Acer Aspire C27-1 All-in-One, 27" FHD, Core i5-13420H / 8GB / 512GB / UHD Graphics / Windows 11 SL | Equipment is necessary to implement the project | 400000 | 2 | 800000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26100579 | Monoblock | Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/8GB/512GB/UHD Graphics/W11SL | Equipment is necessary to implement the project. | 400000 | 5 | 2000000 | october | 50/50 | В период поставки | |
| AP26100579 | Refrigeration equipment | DEXP freezer cabinet F4-28AMA - 275 490 tg Refrigerator LG GC-B509MLWM - 351 490 tg | Equipment is necessary to implement the project. | 626980 | 1 | 626980 | - | 50/50 | В период поставки | |
| AP26100579 | SimpliAmp Amplifier | Thermal cycler for DNA amplification. Used in PCR studies. | Equipment is necessary to implement the project. | 3990517 | 1 | 3990517 | october | 50/50 | В период поставки | |
| AP26100579 | consumables for PCR research | Primer rDNA16S V1-V5 region, Bact-8F, AGAGTTTGATCCTGGCTCAG 2х14560=29120 Primer rDNA16S V1-V5 region, Bact-936R, 4 GTGCGGGCCCCCGTCAATTC 2х14560=29120 D-Cells kit for DNA extraction from animal and bacterial cells, 250 isolations 1х479941,28=479941,28 Agarose for electrophoresis (Low-BEO), 100 g 2х69328=138656 Immunological tablet, 96-well 20х1128,96=22579,20 MiniMed vacuum tube with K2-EDTA, 2ml, 100 pcs 10х11901,12=119011,20 Laboratory test tube 15 ml, conical 17*120 mm with screw eraser 3х50967,84=152903,52 Microcentrifuge tube 1.5 ml, graduated 500 pcs PCR Clean 3х7056=21168 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 1х7840=7840 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 3х10192=30576 bacteriological loop 1 µl with needle colorless (20 pcs/pack) 10х834,18=8341,76 bacteriological loop 10 µl with a colorless needle (20 pcs/pack) 15х834,18=12512,64 Tampon probe MiniMed sterile in a test tube pack of 100 pcs 5х13108,48=65542,40 | To conduct research work | 1117315 | 1 | 1117315 | october | 50/50 | Поставлено | |
| AP26100579 | materials for microbiological research | Diachym is a Gram coloring kit : 3*10900=32700 Petri dishes with PS lid (90×15mm) glass: 100*1400=140000 1ml tip, 500pcs package: 2*9000=18000 Tips 200mkl (1000pcs=1up): 2*9000=18000 Tip for dispenser 10ml IKA: 2*12000=24000 | To conduct research work | 232700 | 1 | 232700 | october | 50/50 | Поставлено | |
| AP26100579 | Nutrient media | Triptic Soy Agar, 2х44500=89000 Triptic Soy Broth, 2х44500=89000 CHROMagar Enterobacter, 2х144000=288000 CHROMagar Staphylococcus, 2х161000=322000 | To conduct research work | 788000 | 1 | 788000 | october | 50/50 | Поставлено | |
| AP26100579 | Samsung Odyssey G4 LS25BG400EIXCI 25 Full HD/IPS/1ms/240Hz Monitor | Screen size: 25″ (63.5 cm) Resolution: 1920×1080 (Full HD) Panel type: IPS Refresh rate: up to 240 Hz Response time: 1 ms (GtG) Brightness: 400 nits Features: AMD FreeSync Premium, NVIDIA G-Sync compatible Ports: DisplayPort 1.2, HDMI 2.0 Adjustments: height, tilt, swivel, VESA mount 100×100 | Equipment is necessary to implement the project. | 104990 | 1 | 104990 | october | 50/50 | Поставлено | |
| AP26100579 | Indesit DS 4200W Refrigerator | Refrigerator for storing biological reagents and samples. | Equipment is necessary to implement the project. | 189990 | 1 | 189990 | october | 50/50 | Поставлено | |
| AP26100579 | CHROM agar Orientation | A chromogenic medium designed for isolation and presumptive identification of microorganisms from clinical samples. Different bacteria produce colonies in distinct colors, enabling rapid and accurate differentiation. | To conduct research work | 281505 | 1 | 281505 | - | 50/50 | В период поставки | |
| AP26100579 | Master Mix Red Taq DNA Polymerase 2X, 1,5 мМ MgCl₂, 500 тестов, Avantor | A ready-to-use mixture for DNA amplification. Contains 1.5 mM MgCl₂ and Taq polymerase. Suitable for 500 tests. Provides convenience and consistent, reliable results. | To conduct research work | 171160 | 1 | 171160 | - | 50/50 | В период поставки | |
| AP26100579 | Veterinary medical consumables | Forceps for dressing 10x2900=29000 Surgical scissors 10x2500=25000 First aid kit 1x14452=14452 Sterile gloves 2x2500=5000 Sterile disposable scalpel 100x1500=150000 Safety glasses closed 10x1250=12500 Filter paper 100×100cm 3x5200=15600 Disposable three-layer mask 100x45=4500 Alcohol, 96% 5x3000=15000 Polyester bags for honey. Waste, class A 4x1500=6000 | To conduct research work | 277052 | 1 | 277052 | - | 50/50 | В период поставки | |
| AP26100579 | consumables for PCR research | Adhesive coating for 96-well plates 100 pcs/pack - 78 881 tg PCR tablets, 96 wells, without stability skirt, colorless, 25 pcs/pack - 75 669 tenge TAE Buffer (Tris-Acetate EDTA) (50X), 1 l. - 65 351 tenge Water without nucleases, 30 ml. - 25 311 tg PCR master mix (2X), 200 reak. - 74 591 tg DNA loading dye in gel (6X), 5 x 1.0 ml. - 38 269 tg DNA Marker GeneRuler 1 kb, 5x50 micrograms. - 93 198 тг | To conduct research work | 451270 | 1 | 451270 | - | 50/50 | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP19680272 | LED screen | Led screen 1860x3300 cm with a resolution of P 2.5 With an acoustic system | Purchase of LED screen for use in conducting a special course developed on the basis of a scientific project and presentation of the project results. | 3285388 | 1 | 3285388 | - | 50/50% | В период поставки | |
| AP19680272 | Publishing books | Publication of a Book Series 1. Publication of an Anthological Collection: volume — 800–950 pages, bound. Print run — 300 copies. Hard cover, white paper. 2. Publication of a Linguistic Dictionary: volume — 180–300 pages, bound. Print run — 100 copies. Hard cover, white paper. 3. Publication of a Monograph: volume — 140–200 pages, bound. Print run — 100 copies. Hard cover, white paper. | Summarizing the results of the project research and publishing scientific products according to the schedule. | 1600000 | 1 | 1600000 | - | 50/50% | Поставлено | |
| AP19680272 | Purchase of office supplies | Purchase of office supplies | The goods are necessary for the implementation of the project | 56098 | 1 | 56098 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР19680032 | Purchasing an interactive panel | nteractive panel MARTITOUCH 75 dm Negyzgi sipattamalary: Android 14 // core processor Jads: 8 Gb LPDDR 4x / 128 Gb Standards: 4K/Ultra HD (3840*2160) Number of tigizu sanas – 50 Zhauap take ukyty – 2.5 milliseconds Koru Buryshy – 178° Contrast sheets – 5000:1 Zhanartu zhiіligi – 60 Hz Zharkyndygy – 400 OPS kosymsha computer ornatuga arnalgan slot Interface: HDMI, USB 2.0, USB 3.0, USBTouch, RJ45, VGA, EARPHON Regarding our computer: Bluetooth 5.0, WiFi 2.4–5 GHz High quality 13 megapixel camera, built-in microphone, speaker. Key features: Screen-mounted, vandalized, toaded, Acoustic, powered – 48 W Zhiyntyk kuramynda: 2 marker, Kashyktan baskar remote control, kuat cables, Vesa bekitkishi (1 dan) Capildik merzimi: 12th OPS i5 8/256 Mobildi terek | Purchase of interactive panels for use in conducting a special course developed on the basis of a scientific project and presentation of the project results | 1251445 | 2 | 2502890 | 50/50% | В период поставки | ||
| АР19680032 | Publishing a monograph | Topic: “Structural-semantic and linguacultural aspects of the vocabulary of social networks” Volume: 140 pages ISBN included. | Summarize the results of the project research and publish the monograph “Structural-semantic and linguacultural aspects of the vocabulary of social networks” in accordance with the calendar plan. | 3250 | 500 | 1625000 | - | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP26198315 | Rotary evaporator model RI-213 | Maximum heating temperature, °C 100 Standard flask capacity, ml 500 to 1000 Motor power, W 25 Heating element power, kW 1.5 Rotation speed, rpm 5…180 Lifting height, mm 130 Power supply, V/Hz 220/50 or 60 Steam power, kW 1.5 Steam dimensions (Ø×H), mm 240×150 Assembled dimensions (W×D×H), m 890×370×760 Assembled weight, kg 17 | Equipment is necessary to implement the project. | 1391000 | 1 | 1391000 | october | 50/50% | В период поставки | |
| AP26198315 | Vacuum Filtration Device Series 400-SF10 (LF32) | Specifications Power supply: 220 V/50 Hz Maximum power consumption, W: 80 Maximum current consumption, A: 0.4 Maximum residual pressure, mmHg: 20 Maximum flow rate, l/min: 20 Motor speed, rpm: 1450 Nipple, inch (mm): 5/16 (8) Dimensions, LxWxH, cm: 33.5x23x45 | Equipment is necessary to implement the project. | 4400000 | 1 | 4400000 | october | 50/50% | В период поставки | |
| AP26198315 | Monoblock | Acer Aspire C27-1 Monoblock, 27"FHD, Core i5-13420H/16GB/512GB/UHD Graphics/W11SL | Equipment is necessary to implement the project. | 440253 | 8 | 3522024 | october | 50/50% | В период поставки | |
| AP26198315 | Reagents | Gram Staining Kit, sodium hydroxide,phenolphthalein,isoamyl alcohol, magnesium stereinate | To conduct research work | 242134 | 1 | 242134 | october | 50/50% | В период поставки | |
| AP26198315 | Nutrient media | MRS agar,selective agar for streptacoccus, nutrient agar | To conduct research work | 585790 | 1 | 585790 | october | 50/50% | В период поставки | |
| AP26198315 | Apparatus for coagulating nutrient media ASIS-01 | Specifications Operating temperature, °C: +40 to +90 Maximum number of simultaneously loaded tubes, 16-21 mm in diameter: 236 Tube tilt angle for horizontal cassette loading, º: 45 to 90 Power consumption, W: no more than 1000 Dimensions, mm: no more than 730×468×850 Weight, kg: no more than 65 | Equipment is necessary to implement the project. | 4650000 | 1 | 4650000 | october | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP27508635 | Steaks | steaks from angus | consumable material | 25500 | 50 | 1275000 | - | 50/50% | В период поставки | |
| AP27508635 | Steaks | steaks from Kazakh white-headed bulls | сonsumable material, расходный материал | 9000 | 50 | 450000 | - | 50/50% | В период поставки | |
| AP27508635 | Refrigerated display case | Refrigerated display, Length, mm:3750 Width, mm:1145 Height, mm:1485 Type:open Voltage:220 V Temperature range:-5...+5°C Cooling type:dynamic Refrigerant:R404A Current frequency:50 Hz | Equipment is necessary to implement the project. | 660000 | 2 | 1320000 | - | 50/50% | В период поставки | |
| AP27508635 | MiniScan EZ 4500L: Portable spectrophotometer | The MiniScan EZ 4500L is a portable spectrophotometer from HunterLab designed to accurately measure the reflected color of various samples. The 45°/0° geometry device (45° lighting, 0° surveillance) is ideal for quality control in production, providing reliable and reproducible results. The lightweight, ergonomic design allows you to operate the device with one hand, while the large, easy-to-read display and intuitive thumb navigation simplify work on production lines, warehouses or laboratories. The firmware includes basic industrial color scales and indexes, making the MiniScan EZ 4500L a universal solution for evaluating the color of fabrics, paper, powders, granules, and even liquids (when using a cuvette). The rugged design and AA batteries ensure mobility and long-term autonomy. | Equipment is necessary to implement the project. | 7995738 | 1 | 7995738 | 50/50% | В период поставки | ||
| AP27508635 | Antimicrobial discs | sterile discs used to test microorganisms' sensitivity to antibiotics. | Equipment is necessary to implement the project. | 3614 | 173 | 625222 | 50/50% | В период поставки | ||
| AP27508635 | Mueller Hinton Agar | Standard growth medium for testing bacterial susceptibility to antibiotics. | Equipment is necessary to implement the project. | 30300 | 1 | 30300 | - | 50/50 | В период поставки | |
| AP27508635 | Buffered Peptone Water | Buffered Peptone Water is a liquid medium used for the pre-enrichment of microorganisms. It supports the survival of bacteria after stress conditions and promotes the recovery of pathogens, particularly Salmonella, prior to detection | Research within the project | 37500 | 2 | 75000 | - | 50/50% | В период поставки | |
| AP27508635 | Gram Coloring Kit | Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml) Цвет: синий, голубой, черный Состав: генциан-виолет (100 мл), раствор Люголя (100 мл) Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml) | Research within the project | 11750 | 2 | 23500 | - | 50/50 | В период поставки | |
| AP27508635 | tip | 1 ml (1000 µl) tip – transparent, PP material, autoclavable, 1000 pcs/package. | Research within the project | 25950 | 2 | 51900 | - | 50/50% | В период поставки | |
| AP27508635 | tip | Tips 200 µl – transparent, PP, autoclavable, 1000 pcs = 1 pack. | Research within the project | 24500 | 1 | 24500 | 50/50% | В период поставки | ||
| AP27508635 | ChroMed E.coli агар, ChroMed E.coli агар, ChroMed E.coli Agar | ChroMed E.coli Agar, уп/100г , ChroMed E.coli Agar, pack/100g, ChroMed E.coli Agar уп/100г , | Research within the project | 42500 | 1 | 42500 | - | 50/50% | В период поставки | |
| AP27508635 | Soy-casein Agar | Packaging type: polyethylene jar Unit of measurement: pack Pack size: 500 g | Research within the project | 23000 | 1 | 23000 | - | 50/50% | В период поставки | |
| AP27508635 | Light glass reaction jar with a blue screw-on plastic lid and 500 ml markings | Material: glass Type: Light glass reagent jar with blue screw-on plastic cap 500 ml with divisions Capacity 500 ml | Research within the project | 3000 | 20 | 60000 | - | 50/50 | В период поставки | |
| AP27508635 | Steaks | steaks from angus | consumable material | 25500 | 50 | 1275000 | December | 50/50 | В период поставки | |
| AP27508635 | Steaks | steaks from Kazakh white-headed bulls | consumable material | 9000 | 50 | 450000 | December | 50/50 | В период поставки | |
| AP27508635 | Shaker | Shaker SK-0330-M A laboratory shaker for uniform mixing and incubation of samples in flasks/tubes with adjustable shaking speed. | Equipment is necessary to implement the project. | 355000 | 1 | 355000 | December | 50/50 | В период поставки | |
| AP27508635 | Вортекс | A vortex mixer for rapid, vigorous mixing of tube contents via circular vibrations. | Equipment is necessary to implement the project. | 210000 | 1 | 210000 | December | 50/50 | В период поставки | |
| AP27508635 | Monitor | A monitor is a display device used to present visual information. It features high resolution, wide viewing angles, and fast response time. Suitable for office tasks, gaming, and graphic design. | Equipment is necessary to implement the project. | 104990 | 1 | 104990 | December | 50/50 | В период поставки | |
| AP27508635 | Refrigerator | A refrigerator is a household appliance designed for cooling and long-term food storage. It features low energy consumption, spacious compartments, and precise temperature control. | Equipment is necessary to implement the project. | 219010 | 1 | 219010 | December | 50/50 | В период поставки | |
| AP27508635 | Mechanical Pipettes | Manual micropipettes for accurate dispensing of small liquid volumes, ensuring precision and repeatability. | Equipment is necessary to implement the project. | 148000 | 1 | 148000 | December | 50/50 | В период поставки | |
| AP27508635 | Water Bath | Temperature-controlled water bath for uniform heating and maintaining set temperatures of samples. | Equipment is necessary to implement the project. | 520500 | 1 | 520500 | December | 50/50 | В период поставки | |
| AP27508635 | Electronic Balance | Electronic laboratory balance for precise weighing of reagents and samples, suitable for analytical tasks. | Equipment is necessary to implement the project. | 250000 | 1 | 250000 | December | 50/50 | В период поставки | |
| AP27508635 | Laboratory Hot Plate | Electronic laboratory balance for precise weighing of reagents and samples, suitable for analytical tasks. | Equipment is necessary to implement the project. | 315000 | 1 | 315000 | December | 50/50 | В период поставки | |
| AP27508635 | Laminar flow cabinet | A laminar flow cabinet with HEPA filtration provides a sterile airflow for safe handling of cultures and reagents, preventing sample contamination. | Equipment is necessary to implement the project. | 2700463 | 1 | 2700463 | December | 50/50 | В период поставки | |
| AP27508635 | Conical (Erlenmeyer) flask with graduation | Conical laboratory flask (Erlenmeyer type) with a nominal volume of 1000 mL and an approximate graduation scale. The mark KN-3 denotes the flask type/version, while “34” refers to the neck/joint size for compatible stoppers or attachments. Designed for preparing, mixing and heating solutions, carrying out reactions, and titration work. The conical shape helps reduce splashing during swirling and provides stable handling. Typically made of heat-resistant, chemically durable laboratory glass. | For conducting laboratory experiments. | 4000 | 5 | 20000 | 100% | В период поставки | ||
| AP27508635 | Tube | A 5 mL laboratory test tube intended for handling small liquid volumes: sampling and storage, qualitative reactions, and solution dilutions. Depending on the model, it may have a round or conical bottom. Typically manufactured from chemically resistant glass; glass tubes can be gently heated in a water bath or over low flame when proper safety procedures are followed. | For conducting laboratory experiments | 69.71 | 200 | 13942 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP19178097 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Required for data analysis and systematic text work. | 400000 | 2 | 800000 | September | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP25796077 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Required for data analysis and systematic text work. | 399990 | 2 | 799980 | September | 50/50% | В период поставки | |
| AP25796077 | Infographic map | Format: Digital (PDF, PNG, SVG) and print version Size: A5 or B5 standards Content layers: historical data, chronological scale, legend symbols Graphic elements: charts, pictograms, map signs Visualization tools: Adobe Illustrator, CorelDRAW, Canva, or ArcGIS StoryMaps Color: full color (CMYK for print, RGB for digital), soft palette comfortable for viewing Design style: minimalist, focused on clear data presentation, with preserved contrast Fonts: suitable Cyrillic and Latin fonts for academic text (Arial, Times New Roman, Open Sans) Paper quality (for print): density 130–170 g/m², matte or glossy finish | It makes it possible to present research findings visually and convey the data clearly. | 1 | 1 | 1 | September | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР25796807 | Laptop Lenovo Yoga Pro 7 14IMH9 | Operating System: Windows 11 Home (x64) SL Processor: Intel Core Ultra 5 Processor Model: 125H Processor Frequency, GHz: 1.2 Integrated Processor Graphics: Intel Arc Graphics RAM Capacity, GB: 32 RAM Configuration: 32 GB (soldered on the motherboard) Number of RAM Slots: None Solid State Drive: 1 TB SSD Screen Size, inches: 14.5 Screen Resolution: 3072 x 1920 | Purchase of a laptop for the material and technical base. | 743386 | 1 | 743386 | 2025 | 50/50% | В период поставки | |
| АР25796807 | Costs of work performed by outside organizations | Publication of an article in journals recommended by the Science and Higher Education Quality Assurance Committee of the Ministry of Science and Higher Education of the Republic of Kazakhstan | For the publication of a scientific research article within the framework of the project | 56064 | 1 | 56064 | 2025 | 50/50% | В период поставки | |
| АР25796807 | Scientific research service | Testing samples using the PCR method | PCR testing of samples collected within the framework of the project. | 9843 | 150 | 1476450 | September | 100 | В период поставки | |
| АР25796807 | Reagents and consumables for PCR analysis | 1. Taq DNA Polymerase, with standard Taq buffer, without magnesium, 5000 U/ml, 400 U, New England Biolabs, M0320S – 2 packs 2. dNTP Mix, 10 mM, 8 μM, 4×0.2 ml, New England Biolabs, N0447S – 2 packs 3. RIBO-prep Kit, Form 2, AmpliSens, K2-9-Et-100 – 2 kits 4. Microcentrifuge tubes, 1.5 ml, clear, DNase/RNase-free, non-sterile, 5000 pcs/pack, Biologix, 80-1500 – 2 packs 5. Axygen PCR tubes, 0.2 ml, thin-walled, flat cap, clear, non-sterile, 1000 pcs/pack, Corning, PCR-02-C – 2 packs 6. Filter tips, 10 µl, in racks, sterile, DNase/RNase and pyrogen-free, length 46 mm, 96 tips/rack, 960 pcs/pack, Biologix, 23-0010S – 2 packs 7. Axygen® universal filter tips, 200 µl, clear, in racks of 96 tips, 960 pcs/pack, Axygen, TF-200-R-S – 2 packs 8. (1-Hexadecyl)trimethylammonium bromide (CTAB), 100 g, Glentham Life Sciences, GD0341-100g – 3 packs 9. Filter tips, 1000 µl, in racks, sterile, DNase/RNase and pyrogen-free, length 102 mm, 96 tips/rack, 50 racks/pack, Biologix, 23-1000S – 1 pack | Research within the project | 1223912 | 1 | 1223912 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP25796649 | Scientific research service | Laboratory services for the determination of organoleptic, physico-chemical, biochemical, microbiological parameters, heavy metals and minerals. | To provide an experiment. | 800 | 1 | 800 | 2025 | 50/50% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | Milk | To provide an experiment. | 500 | 200 | 100000 | - | 100% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | Buttermilk | To provide an experiment | 350 | 200 | 70000 | - | 100% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | Dry serum | To provide an experiment. | 800 | 50 | 40000 | - | 100% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | Horse fat | To provide an experiment. | 2500 | 20 | 50000 | - | 100% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | Sea salt | To provide an experiment. | 550 | 5 | 2750 | - | 100% | В период поставки | |
| AP25796649 | Procurement of materials, equipment, and/or software | The Lactane 1-4 М milk analyzer measures all indicators of milk in 1 minute, thereby detecting falsification and compliance with established price categories. To accurately calculate the result, you need to know how much fat, protein, SOMO, what is the density of milk, how much water is in it, and determine the freezing point. You can analyze not only the milk of cows, but also other animals: goats, buffaloes, sheep. | Equipment is necessary to implement the project. | 500000 | 1 | 500000 | - | 100% | В период поставки | |
| AP25796649 | Scientific research service | Laboratory services for the determination of fatty acid composition and physicochemical parameters | Research within the project | 108900 | 1 | 108900 | - | 100% | В период поставки | |
| AP25796649 | Laptop | Lenovo ThinkBook 16 G8 IRL Laptop, Core i5-13420H/16"WUXGA/16GB/512GB/UHD Graphics/LAN/W11H | Purchase of a laptop for the material and technical base. | 510 | 1 | 510 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23489475 | hard drive | External hard drive Transcend, StoreJet 25H3 1TB HDD USB 1 TB TS1TSJ25H3P, USB3.0, ext., power via USB | The project requires an external hard drive for reliable storage and backup of large amounts of data, including 3D models, photo/video materials, and research archives. The device will ensure the security of information and the convenience of working with data in field and office conditions. | 44 | 1 | 44 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Backpack | MarketOnline 504Blue trekking Backpack 50 L blue | Field work requires a trekking backpack adapted for long-term expeditions and carrying heavy equipment. It will provide comfort, even load distribution and protection of the contents in difficult natural conditions. | 17 | 1 | 17 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Шпатель / Шпатель / spatula | Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field. | Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field. | 6 | 1 | 6 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Sleeping bag | Fleece sleeping bag-liner single tourist | Archaeological expeditions require a sleeping bag to keep participants working, regardless of weather conditions and temperature. | 5 | 1 | 5 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Tent | High Peak Minilite 2 Tent blue | a tent for ensuring the protection of field workers from adverse weather conditions and the convenience of living in the field | 25 | 1 | 25 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Gloves | work gloves | Archaeological work requires protective gloves, which will ensure the safety of hands when working with tools, finds and soil. They will help to avoid injury, contamination and provide convenience in the field. | 72 | 1 | 72 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Bayonet shovel | Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field. | Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field. | 3 | 1 | 3 | 2025 | 50/50% | В период поставки | |
| АР23489475 | Shovel | Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field. | Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field. | 3 | 1 | 3 | 2025 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР2З484846 | Laboratory research | Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine + isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) by capillary electrophoresis Determination of fatty acid composition by GLC Determination of the mass fraction of fiber Determination of the amount of vitamins E (α, β, γ, δ) by HPLC Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by capillary electrophoresis Determination of the amount of β - carotene Determination of fat-soluble antioxidants Determination of water-soluble antioxidants Determination of iron Determination of zinc Determination of magnesium Determination of calcium Determination of phosphorus Determination of iodine in 1 sample | Required for the completion of the research project | 168300 | 1 | 168300 | june | 50/50% | В период поставки | |
| АР2З484846 | Horse meat-20 kg * 3700 = 74000 tenge turkey meat-5 kg*2400 = 12000 tenge chicken fillet-5 kg*2000 = 10000 tenge beef - 120 kg * 4000 tenge = 480000 tenge Lamb - 20 kg * 3700 = 74000 tenge tail fat - 10 kg * 4000 = 40000 tenge green buckwheat - 10 kg * 1200 tenge= 12000 tenge wheat flour 10 kg * 360 tenge = 3600 tenge | Conducting laboratory work in accordance with the calendar plan | 705600 | 1 | 705600 | november | 100% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24992981 | Services for rent | Housing rental services for field expeditions | Necessary to perform calendar tasks of the Program | 2624000 | 1 | 2624000 | may | 50/50% | В период поставки | |
| BR24992981 | Scientific research service | Training course on the use of geoinformation system ESRI ArcGIS | The service is necessary for the implementation of the Program. | 842800 | 1 | 842800 | may | 50/50% | В период поставки | |
| BR24992981 | Scientific research service | Conducting a sociological study of the current state of recreational tourism in Kazakhstan, including the Alakol region, and its importance, as well as general tourism services and their quality. Conducting sociological research on the effective use of the balneological resources of the Barlyk-Arasan resort and the state of resort medicine | This service is necessary to perform calendar tasks of the Program | 12000000 | 1 | 12000000 | july | 50/50% | В период поставки | |
| BR24992981 | Providing servicese | Chemical, biochemical, microbiological analysis of the composition of mineral waters and medicinal mud of the Alakol basin | Necessary to perform calendar tasks of the Program | 1736000 | 1 | 1736000 | - | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP19579443 | Спектрофотометр СФ-2000 | The spectrophotometer is designed to measure the spectral coefficients of directional transmission of liquid and solid transparent samples. The detectors are CCD rulers with high sensitivity and resolution parameters. The high-speed USB communication interface with the computer provides fast bidirectional data exchange with the computer, increasing operator comfort. | The device is necessary for conducting research to determine the ratios of polymers in the initial mixture to be applied to the soil. | 3591800 | 1 | 3591800 | Май-декабрь | 30/70% | Поставлено | |
| AP19579443 | Стимулятор роста растений | YaraVita BioNUE™ Plant Growth Stimulation Solution | It is necessary for conducting pilot tests of the technology. | 264000 | 1 | 264000 | Май-июнь | 100% | Поставлено | |
| AP19579443 | Стимулирующий раствор для роста растений | Plant Growth Stimulation Solution TRAINER" | It is necessary for conducting pilot tests of the technology." | 200550 | 1 | 200550 | Май-июнь | 100% | Поставлено | |
| AP19579443 | Nitroammophoska. Complex fertilizers for plant growth and development | It is necessary for conducting pilot tests of the technology. | 12250 | 1 | 12250 | Май-июнь | 100% | Поставлено | ||
| AP19579443 | Удобрение | YaraTera KRISTALON 12-12-36 RED | It is necessary for conducting pilot tests of the technology. | 124875 | 1 | 124875 | Май-июнь | 100% | Поставлено | |
| AP19579443 | Удобрение | Ammonium nitrate | It is necessary for conducting pilot tests of the technology. | 27750 | 1 | 27750 | Май-июнь | 100% | Поставлено | |
| AP19579443 | Monoblock Acer Aspire 27" | Моноблок Acer Aspire C27-2G (Black)/ Intel Core i5 13420h/ 32 ГБ DDR4 3200/ 512 ГБ M.2 NVME SSD/ 27"FullHD IPS non-touch/ 802.11axWiFi6+BT5.0/ беспроводные Kb+M/ Windows 11 + Office LTSC Standard 2024 | Purchase of a monoblock for the material and technical base | 500000 | 3 | 1500000 | September | 50/50% | В период поставки | |
| AP19579443 | 3.0 kW heating element | spare part for the Livam AE-4 distiller | To prepare water for work | 42237 | 2 | 84474 | September | 100 | В период поставки | |
| AP19579443 | ADS Multi Acid Decomposition System | The system is designed for sample preparation of samples for elemental analysis: the material of the heating unit is graphite with Teflon coating, The number of tubes to be installed in one heating unit is 16 for 100 ml and 9 for 50 ml. Heating temperature - 250 C, The power is not more than 3.2 kW. | The device is necessary to prepare soil samples for chemical analysis. | 3000000 | 1 | 3000000 | - | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24992916 | High cross-country ability in off-road conditions, large capacity). The Stone Age Study Group. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1200000 | 1 | 1200000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity) | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1200000 | 1 | 1200000 | may-december | 70/30% | В период поставки | |
| BR24992916 | motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Early iron age | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1200000 | 1 | 1200000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Monument vault squad. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 2000000 | 1 | 2000000 | may december | 70/30% | Поставлено | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). A group for the study of Early Iron Age settlements. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1400000 | 1 | 1400000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). The group for the study of burial mounds of the elite of the Early Iron Age. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1400000 | 1 | 1400000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Ethno-archaeological group. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1200000 | 1 | 1200000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity).Exploration Squad (Medieval times) | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1000000 | 1 | 1000000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Monograph by Samashev Z.""The visual activity of the ancient population of the Kazakh | Technical specifications of the publication: Format: 84 × 108 1/16 Volume: 300 pages Block printing: full color (4+4 cr.) Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: one-sided printing (4+0 gr.), lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies | The publication of the monograph of the Doctor of Historical Sciences, Professor Zainolla Samashev "The visual activity of the ancient population of the Kazakh Altai" is a significant contribution to the development of national and world archaeological science. The work is based on many years of archaeological research conducted in the region of Eastern Kazakhstan, rich in unique rock art monuments. | 3491100 | 1 | 3491100 | may-december | 50/50% | В период поставки | |
| BR24992916 | Monograph by Oshanov O. "Kazakh agricultural calendar". | Technical specifications of the publication Monograph: Oshanov O. ""Kazaktyn sharuashylyk kuntizbesi"" Format: 84 × 108 1/16 Volume: 380 pages Block printing: full-color, 4+4 colors Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: 4+0 cu., lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies | O. Oshanov's monograph "Kazaktyn sharuashylyk kuntizbesi" is devoted to a little-studied but extremely important aspect of the traditional culture of the Kazakh people - the system of economic and calendar knowledge. It explores the historical and ethnographic basis of the national calendar, its connection with the cycles of nomadic economy, natural rhythms and rituals reflecting the way of life of Kazakhs for centuries. | 3870000 | 1 | 3870000 | may-december | 50/50% | В период поставки | |
| BR24992916 | Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum. | Technical specifications of the publication Publication: Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum Format: 70 × 100 1/8 (book) — 24.5 × 29 cm (height) Volume: 416 pages Block printing: full color (4+4 colors) Coated paper, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Decoration: 4+0 gr., lamination, foil stamping Binding paper: coated, density 150 g/m2 Circulation: 300 copies | The publication of the Catalog of Archaeological Collections of Kazakhstan is a fundamental scientific reference work, including a systematic description of artifacts stored in the collections of the museum of the Abai region. The catalog provides an opportunity for a comprehensive analysis and study of archaeological finds reflecting various stages of historical development in Kazakhstan. | 4257000 | 1 | 4257000 | may-december | 50/50% | В период поставки | |
| BR24992916 | Earthworks. Medieval Monuments Study Group | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the Medieval monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the medieval period on the territory of Kazakhstan, namely the Abai region. | 4500000 | 1 | 4500000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Earthworks. The Early Iron Age Study Group. | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region. | 11550000 | 1 | 11550000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Excavation team for the study of the Early Iron Age. | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region. | 11550000 | 1 | 11550000 | may-december | 70/30% | В период поставки | |
| BR24992916 | Earthworks. Early iron age Study Group | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region. | 4500000 | 1 | 4500000 | june-december | 70/30% | В период поставки | |
| BR24992916 | Earthworks. The Bronze Age Study Group | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region. | 4500000 | 1 | 4500000 | июнь-декабрь | 70/30% | В период поставки | |
| BR24992916 | Earthworks. The Bronze Age Study Group | Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region. | 4500000 | 1 | 4500000 | june-december | 70/30% | В период поставки | |
| BR24992916 | Earthworks. The Stone Age Study Group | Type of work: Land work (archaeological excavation work).Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition. | The excavation work carried out by the Stone Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Stone Age on the territory of Kazakhstan, namely the Abai region. | 4500000 | 1 | 4500000 | июнь-декабрь | 70/30% | В период поставки | |
| BR24992916 | Primary conservation and restoration of discovered finds. | Primary conservation and restoration of discovered archaeological finds. Types of processed materials: Metals (bronze, iron, copper, silver, gold), Ceramics (ceramic vessels, fragments, fragments), Stone (ornamented or worked stones), Organic materials (bone, wood, leather, textiles, plants), glass, etc. The result of the work: Preservation of the historical value of the finds, Preparation of objects for further scientific research, Preparation for an exhibition or transfer to museum collections, a scientific report describing the condition of objects, restoration methods and condition after work, etc. | Primary conservation and restoration are an integral stage of archaeological research and include: Stabilization of the state of finds to prevent destruction; Mechanical and chemical cleaning of impurities and salts; Fixing and strengthening fragments, including joining crumbled objects; Preparation of objects for further storage, research and museum exposition. Without timely primary processing, many objects lose their scientific value and may be lost. | 1067529 | 1 | 1067529 | июнь-декабрь | 100% | В период поставки | |
| BR24992916 | Radiocarbon analysis To obtain the absolute age of the monument (bone, collagen). | Radiocarbon dating: obtaining the absolute age of the monument (bone, collagen). Type of samples: Human or animal bones. Analysis results: The absolute date of the object or layer in calibrated years, taking into account the error. An indication of potential limitations related to calibration or the condition of the sample. A scientific report with photofixation, graphs and tables, as well as possible conclusions based on the dating results. The result of the work: Obtaining accurate dating (in calendar years) for archaeological sites, burials or objects. Using radiocarbon dating to synchronize with other dating methods and analyze cultural layers. | Radiocarbon dating (14C) is one of the most accurate and widely used methods for obtaining an absolute chronology of archaeological sites. In the case of animal or human bone analysis, the main source for dating is collagen, an organic protein that is resistant to postdepositional changes with good preservation. Conducting a 14C analysis allows you to: Establish the absolute age of an archaeological site or cultural layer; Link certain finds to a specific historical period; Clarify the chronological framework of the monument's existence, building stages, burials, etc.; Use the data in a comparative analysis with other monuments in the region. The results of radiocarbon dating are an important part of scientific interpretation and are mandatory in preparation for publications and museum catalogues. | 221428 | 12 | 2657136 | июнь-декабрь | 100% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Bronze Age Monument Exploration Squad. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 400000 | 1 | 400000 | november-december | 70/30% | В период поставки | |
| BR24992916 | Radiocarbon analysis To obtain the absolute age of the monument (bone, collagen). | Radiocarbon dating: obtaining the absolute age of the monument (bone, collagen). Type of samples: Human or animal bones. Analysis results: The absolute date of the object or layer in calibrated years, taking into account the error. An indication of potential limitations related to calibration or the condition of the sample. A scientific report with photofixation, graphs and tables, as well as possible conclusions based on the dating results. The result of the work: Obtaining accurate dating (in calendar years) for archaeological sites, burials or objects. Using radiocarbon dating to synchronize with other dating methods and analyze cultural layers. | Radiocarbon dating (14C) is one of the most accurate and widely used methods for obtaining an absolute chronology of archaeological sites. In the case of animal or human bone analysis, the main source for dating is collagen, an organic protein that is resistant to postdepositional changes with good preservation. Conducting a 14C analysis allows you to: Establish the absolute age of an archaeological site or cultural layer; Link certain finds to a specific historical period; Clarify the chronological framework of the monument's existence, building stages, burials, etc.; Use the data in a comparative analysis with other monuments in the region. The results of radiocarbon dating are an important part of scientific interpretation and are mandatory in preparation for publications and museum catalogues. | 1649753 | 1 | 1649753 | november-december | 100% | В период поставки | |
| BR24992916 | Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Exploration Team of the Medieval Period of Eastern Saryarka. | Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions. | For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc. | 1360000 | 1 | 1360000 | ноябрь-декабрь | 70/30% | В период поставки | |
| BR24992916 | Metallographic analysis of finds | Metallographic analysis is a method of studying materials aimed at revealing their internal structure. It provides insight into the structure, properties, and formation characteristics of a material, making it an important tool for studying archaeological finds. | Metallographic analysis is essential for obtaining objective information about the internal structure of the material being studied. This method allows us to identify the characteristics of its formation and state, which is essential for the accurate interpretation of the study results and subsequent conclusions. | 2100417 | 1 | 2100417 | 100 | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23488882 | Monoblock | 27" Моноблок Моноблок Monoblock 27 Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional | Purchase of monoblocks for the opening of the Academic writing center | 465455 | 1 | 465455 | may | 100% | Поставлено | |
| АР23488882 | Speaker | Frequency range 80-18000 Hz | Purchase of a speaker for working with electronic educational resources | 9788 | 1 | 9788 | may | 100% | В период поставки | |
| АР23488882 | polygraphy services | Publication of the manual | development of students' academic writing skills in English | 4000 | 100 | 400000 | may | 100% | Поставлено | |
| АР23488882 | polygraphy services | Publication of the manual | development of students' academic writing skills in English | 4000 | 100 | 400000 | may | 100% | Поставлено | |
| АР23488882 | polygraphy services | publication of the monograph | Systematization and dissemination of knowledge gained during the project implementation process | 4500 | 100 | 450000 | may | 100% | В период поставки | |
| АР23488882 | polygraphy services | publication of an analytical review | Dissemination of information on the research topic | 2500 | 50 | 125000 | may | 100% | В период поставки | |
| АР23488882 | polygraphy services | Assigning an ISBN code | Identification of book publications | 11000 | 4 | 44000 | may | 100% | Поставлено | |
| АР23488882 | The MLS400 Residual Current Device | The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts. | needed for the completion of the project | 1600000 | 1 | 1600000 | may | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24992914 | Scientific research service | 1. Research on the production of biohydrogen, bioethanol, and biobutanol from distillery waste, coffee, their various mixtures, fruit waste and their mixtures with glycerol and coffee using different bacteria. 2. Study of changes in metabolic properties and pathways in wild-type S. cerevisiae (W303-1B) and mutant strains (Δhap4, ρ0) under fermentation and respiration conditions at different external pH levels and carbon sources. | The service is necessary to complete the project. | 10000000 | 1 | 10000000 | april | 50/50% | Поставлено | |
| BR24992914 | Scientific research service | - Conducting research on the use of hydrogen for the extraction of valuable organic compounds from lignocellulosic materials. - Conducting research on the analysis of total phenolic content, flavonoids, anthocyanins, beta-carotene, chlorophyll a and b, as well as phenolic profile, organic acid profile, sugar profile, and vitamin C content | The service is necessary to complete the project. | 6000000 | 1 | 6000000 | april | 50/50% | Поставлено | |
| BR24992914 | Scientific research service | Study of substance composition: analysis of sugars by HPLC, organic acids, and other components | The service is necessary to complete the project. | 988000 | 1 | 988000 | may | 50/50% | Поставлено | |
| BR24992914 | Scientific research service | Conducting research and development of new bifunctional materials for capturing and processing by-products from molecular hydrogen production: synthesis of activated carbon from plant waste, testing the resulting material as a sorbent for carbon dioxide (CO₂) capture, determining CO₂ sorption capacity, and studying the main CO₂ sorption sites using temperature-programmed desorption (TPD-CO₂) method | The service is necessary to complete the project. | 5000000 | 1 | 5000000 | may | 50/50% | Поставлено | |
| BR24992914 | Scientific research service | Modernization and update of the scientific program website | The service is necessary to complete the project. | 130000 | 1 | 130000 | May | 50/50% | Поставлено | |
| BR24992914 | Scientific research service | Provision of the service for preparing and filing a utility model patent application | The service is necessary to complete the project. | 400000 | 1 | 400000 | may | 50/50% | Поставлено | |
| BR24992914 | Cuvette test COD, measuring range 5–60 mg/l, 25 tests LCK1414 | For measuring low concentrations of COD | Needed for photometric analysis required to evaluate experimental results | 178000 | 1 | 178000 | - | 50/50% | В период поставки | |
| BR24992914 | COD cuvette test measuring range 100–2000 mg/l, 25 tests LCK514 | For analyzing medium COD concentrations | Needed for photometric analysis required to evaluate experimental results | 181000 | 1 | 181000 | - | 181000 | В период поставки | |
| BR24992914 | COD Test’N Tube, measuring range 200–15000 mg/l, 150 tests 2415915 | For determining high COD concentrations | Needed for photometric analysis required to evaluate experimental results | 595000 | 1 | 595000 | - | 50/50% | В период поставки | |
| BR24992914 | LCK338 Laton Total Nitrogen cuvette test 20–100 mg/l, 25 tests LCK338 | For measuring total nitrogen in water samples. | Needed for photometric analysis required to evaluate experimental results | 225000 | 1 | 225000 | - | 50/50 | В период поставки | |
| BR24992914 | Phosphate (ortho/total) cuvette test measuring range 0.05–1.5 mg/l PO₄-P, 25 tests LCK349 | For precise determination of low concentrations of ortho- and total phosphate | Needed for photometric analysis required to evaluate experimental results | 181000 | 1 | 181000 | - | 50/50% | В период поставки | |
| BR24992914 | Phosphate (ortho/total) cuvette test measuring range 2.0–20 mg/l PO₄-P, 25 tests LCK350 | For analyzing higher concentrations of ortho- and total phosphate | Needed for photometric analysis required to evaluate experimental results | 181000 | 1 | 181000 | - | 50/50% | В период поставки | |
| BR24992914 | Organic Acids cuvette test measuring range 50–2500 mg/l, 25 tests LCK365 | For determining organic acid content | Needed for photometric analysis required to evaluate experimental results | 181000 | 1 | 181000 | - | 50/50% | В период поставки | |
| BR24992914 | Dipotassium phosphate trihydrate (K₂HPO₄·3H₂O, hydrated) | A white crystalline powder, highly soluble in water. The aqueous solution is slightly alkaline. Molecular weight: 228.22 g/mol. | Buffering agent, stabilizer, used in laboratories and microbiological media. | 250000 | 1 | 250000 | - | 50/50 | В период поставки | |
| BR24992914 | Peptone (meat-based), AR Grade/GR (500 g) | А product of partial enzymatic breakdown of animal protein (usually of meat origin), which is a light beige powder, highly soluble in water, of AR Grade / GR purity class, suitable for microbiological and biochemical research. | Required for biochemical and microbiological research | 90000 | 1 | 90000 | - | 50/50 | В период поставки | |
| BR24992914 | Bacteriological agar (agar-agar), AR Grade/GR (500 g) | A naturally occurring polysaccharide isolated from red algae (Rhodophyceae). Appearance: Light beige granules or powder, odorless. Solubility: Soluble in hot water, forms a strong gel upon cooling. Purity: AR Grade / GR – analytical and guaranteed purity, suitable for microbiological and biochemical research. | Required for biochemical and microbiological research | 252000 | 1 | 252000 | - | 50/50 | В период поставки | |
| BR24992914 | Sodium carbonate (Na₂CO₃) | An inorganic compound that is a white crystalline powder, highly soluble in water, with an alkaline reaction; it is used as an analytical grade reagent (AR Grade / GR) in laboratory, microbiological, chemical and food analysis for the preparation of buffer solutions, acid neutralization, titrimetric determinations and pH regulation of the environment. | Necessary for the preparation of buffer solutions, neutralization of acids, titrimetric determination and regulation of pH of the medium. | 43000 | 1 | 43000 | - | 50/50 | В период поставки | |
| BR24992914 | Folin–Ciocalteu reagent (indicator), 500 mL | A bluish-green chemical reagent, a mixture of phosphomolybdic and phosphotungstic acids, used as a redox indicator in biochemical and analytical studies. It is used for the quantitative determination of phenolic compounds, amino acids, and proteins (e.g., in the Lowry method, for determining total polyphenol content using Gall or Gallic acid). | Required for quantitative determination of phenolic compounds, amino acids and proteins | 180000 | 1 | 180000 | - | 50/50 | В период поставки | |
| BR24992914 | Aluminum chloride (AlCl3) (1 kg) | An inorganic compound that appears as white or slightly yellowish crystals, highly soluble in water, ethanol, and other polar solvents. It is highly hygroscopic and has an acidic solution. It is used as an analytical-grade reagent (AR Grade/GR) in laboratory, chemical, and biochemical analyses. | Required for biochemical and microbiological research | 47000 | 1 | 47000 | - | 50/50 | В период поставки | |
| BR24992914 | Aluminum chloride (AlCl₃), 1 kg/Sodium acetate (CH₃COONa), anhydrous, 1 kg | Anhydrous is an inorganic compound that is a white, odorless, crystalline powder (or granules), highly soluble in water, alcohols and glycerin, with a slightly alkaline reaction, a molecular weight of 82.03 g/mol | Required for biochemical and microbiological research | 109000 | 1 | 109000 | - | 50/50 | В период поставки | |
| BR24992914 | Potassium-sodium tartrate tetrahydrate, analytical grade, EMSURE® ACS, ISO, Reag. Ph Eur (100 mL) | A crystalline inorganic compound that appears as colorless or white crystals, readily soluble in water, with a neutral or slightly alkaline reaction; it is used as a reagent of high analytical purity (meets the requirements of ACS, ISO, and the European Pharmacopoeia) | Required for biochemical and microbiological research | 135000 | 1 | 135000 | - | 50/50 | В период поставки | |
| BR24992914 | Glucose, 500 g | An organic compound that is a white crystalline powder with a sweet taste, highly soluble in water, belonging to the monosaccharides (aldehyde alcohols); it is used in biochemical, microbiological and analytical studies as a source of carbon and energy, as well as in nutrient media, fermentation processes and standard solutions due to its high purity (AR Grade / GR). | Required for biochemical, microbiological and analytical research. | 18740 | 1 | 18740 | - | 50/50 | В период поставки | |
| BR24992914 | Sodium hydroxide (NaOH) | А white crystalline substance with a strong alkaline reaction, highly soluble in water, used as an analytical-grade reagent for neutralizing acids and preparing solutions in chemical and biochemical analysis. | Required for biochemical and microbiological research | 15000 | 1 | 15000 | - | 50/50 | В период поставки | |
| BR24992914 | Potassium hydroxide (KOH) | A white crystalline substance with a strong alkaline reaction, readily soluble in water and alcohols; used as an analytical-grade reagent for neutralizing acids and preparing buffer solutions. | Required for biochemical and microbiological research | 71840 | 1 | 71840 | - | 50/50 | В период поставки | |
| BR24992914 | Yeast extract | A nutrient component in the form of a light beige powder, highly soluble in water; used as a source of amino acids, vitamins, and growth factors in microbiological nutrient media. | Required for biochemical and microbiological research | 78000 | 1 | 78000 | - | 50/50 | В период поставки | |
| BR24992914 | Potassium dichromate (K₂Cr₂O₇), Extra Pure | Orange-red crystals, highly soluble in water; strong oxidizing agent, used as a high-purity reagent (EXTRA PURE) in analytical chemistry, titrimetry and photometry | Required for biochemical and microbiological research | 64000 | 1 | 64000 | - | 50/50 | В период поставки | |
| BR24992914 | Storage cabinet MD 4-800 | Reagent storage cabinet, W800 x D400 x H1750 + 100 + 70 mm: The cabinet is made of steel, with a 0.6 mm thick frame and 0.7 mm thick door. The door is equipped with key locks (one is installed on the top and one on the bottom door). The handle is plastic (125 mm). The maximum load on the metal shelf is 30 kg. There are two shelves in the upper section and two shelves in the lower section. The shelves are perforated for ventilation. A 100 mm diameter metal pipe is attached to the top. The lower part of the rear wall is equipped with ventilation holes. | Required for storing chemical reagents | 460000 | 1 | 460000 | - | 50/50 | В период поставки | |
| BR24992914 | "Holographic displays and holographic systems" | Displays and holographic systems" Golo " - 144×81 cm internal Composite display-column, including manufacturing and installation | Equipment is necessary to implement the project | 3000000 | 1 | 3000000 | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP23485629 | A test kit for determining the antibiotic in meat and milk | The test kit is designed for rapid and accurate detection of antibiotic residues in meat and milk, including tetracyclines, beta-lactams, streptomycin, chloramphenicol, and sulfonamides. It offers high sensitivity, is easy to use, and suitable for both laboratory and field applications. | Research within the project | 4041401 | 1 | 4041401 | may | 50/50% | Поставлено | |
| AP23485629 | Chromatographic column | Research within the project | A chromatographic column is intended for the separation and quantitative analysis of antibiotics using liquid chromatography. The column is a cylindrical tube packed with a stationary phase (sorbent), through which a mobile phase (eluent) is passed. Due to the interaction between antibiotics and the sorbent, effective separation is achieved, enabling accurate determination of their quantitative levels in the analyzed samples. | 1 | 1 | 1 | may | 50/50% | Поставлено | |
| AP23485629 | Fridge | Temperature range: +2…+8 °C Volume: 300 L Cooling system: static Control: electronic with display Body: metal, inner chamber — ABS/stainless steel Shelves: adjustable Alarm system: temperature, door, power supply Power supply: 220 V, 50 Hz Additional features: lock, temperature recording, emergency power supply | Research within the project | 300 | 1 | 300 | may | 50/50% | Поставлено | |
| AP23485629 | Standard sample for Akvilon AKV-07MK (set) | Purpose: Calibration and testing of the Akvilon AKV-07MK gas analyzer Set includes: cylinders with standard gas mixtures, pressure regulator, connection hoses, certificate Gas types: methane (CH₄), propane (C₃H₈), butane (C₄H₁₀), others upon request Cylinder volume: 1–5 L (depending on configuration) Pressure: up to 150 atm Composition accuracy: ±2% Storage conditions: +5…+25 °C, dry environment Shelf life: up to 2 years | Research within the project | 801 | 1 | 801 | may | 50/50% | Поставлено | |
| AP23485629 | Electric Meat Grinder QJH-C12A | The QJH-C12A electric meat grinder is designed for fast and efficient meat processing in kitchens and small production facilities. It features a 750 W motor operating on 220 V, providing a capacity of up to 120 kg per hour. The housing, knives, and grinding plates are made of stainless steel, ensuring durability and sanitary safety. With a weight of about 19 kg and compact dimensions, the unit is suitable for tabletop installation. Country of origin: China. | Required for sample preparation and grinding of meat materials during laboratory studies within the scientific project. | 150000 | 1 | 150000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Tagler PN-3030Ch Laboratory Heating Plate | The laboratory hot plate TAGLER PN-3030CH is designed for general heating, drying and thermal treatment of solutions, mixtures, samples and specimens. Its working surface is cast iron, size 300×300 mm, providing uniform heat distribution; the temperature range is from +50 °C to +400 °C. The plate has power of 3 kW and is powered from a 220 V mains. Its dimensions are approximately 320×350×140 mm, weight up to 12 kg. Temperature is controlled simply via a rotary knob — easy operation. | For laboratory experiments requiring heating, drying or thermal treatment of solutions and samples. | 290000 | 1 | 290000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Laboratory Scales VK: VK-600.1 (Massa-K) | VK-600.1 laboratory scales are designed for static mass measurements with high accuracy. Maximum weighing capacity is 600 g, readability (division) is 0.02 g. The weighing platform is round (Ø 120 mm) and includes a draft shield. Scales have an LCD display with backlight, can operate from mains or internal battery, support multiple weighing modes: weighing, tare compensation, total mass calculation, percentage and counting modes. An RS-232 interface is available for connection to a computer. | Required for precise measurement of samples, reagents and components during sample preparation and laboratory analytical studies. | 180000 | 2 | 360000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Anatomical Tweezers | An anatomical tweezers is a laboratory instrument used for precise gripping, holding and transferring small samples, tissues and materials. Typically made of stainless steel, it features serrated tips for secure handling without damaging the specimen. Used in biological, veterinary, medical and chemical laboratories. | Required for precise sample handling during laboratory research, sample collection and material preparation within the scientific project. | 3000 | 5 | 15000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Knife Set (China) | A knife set is a collection of versatile cutting tools used for processing, slicing and preparing various samples and materials. The blades are typically made of stainless steel for durability and corrosion resistance, while the handles are made of plastic or composite materials for safe and comfortable grip. Suitable for laboratory, training and general-purpose applications. | Required for preparation and cutting of samples during laboratory experiments and practical tasks within the scientific project. | 15000 | 2 | 30000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Cutting Board (China) | A cutting board is used to safely and conveniently prepare samples, products and materials. It is typically made of moisture-resistant plastic or wood-polymer composites, providing a durable and easy-to-clean surface. It offers a stable working area and protects laboratory benches from damage. | Required for preparation and handling of samples during laboratory procedures and research within the scientific project. | 9000 | 2 | 18000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Surgical Scissors. Material — Stainless Steel | Surgical scissors are made of corrosion-resistant medical stainless steel suitable for repeated sterilization. They provide precise cutting of soft tissues, materials, and laboratory supplies. Compatible with autoclaving and chemical disinfection. | Needed for precise cutting of samples and materials in veterinary-sanitary examinations | 10000 | 5 | 50000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Surgical Tweezers 200 mm | The 200 mm surgical forceps are made of medical stainless steel resistant to corrosion and repeated sterilization. They ensure a secure grip of tissues, materials, and small objects. The gripping surfaces are textured to prevent slipping and provide precise handling. | Required for gripping and holding samples and materials in veterinary-sanitary examinations. | 2500 | 5 | 12500 | April-December | 50/50% | В период поставки | |
| AP23485629 | Gram Staining Kit | The Gram staining kit includes crystal violet, Lugol’s iodine solution, a decolorizer (alcohol or acetone-based), and a counterstain (safranin or fuchsin). It is designed for differential staining of bacteria into Gram-positive and Gram-negative groups. Provides clear visualization of bacterial morphology and cell structure. Suitable for use in microbiological laboratories of various profiles. | Required for detecting and differentiating bacteria during laboratory analyses. | 14000 | 3 | 42000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Chemical Reagents Kit for Veterinary-Sanitary Meat Examination (Medstandart Russia) | The chemical reagents kit for veterinary-sanitary meat examination (Medstandart, Russia) contains reagents for key qualitative and rapid tests, including assessment of meat freshness, detection of ammonia, amines, hydrogen sulfide, peroxidase activity, residual chlorine, and pathological changes. The reagents are supplied in sealed containers, stable during storage, and suitable for both field and laboratory use. | Required for performing qualitative tests and evaluating meat freshness during laboratory analyses. | 30000 | 3 | 90000 | April-December | 50/50% | В период поставки | |
| AP23485629 | Chemical Reagents Kit for Veterinary-Sanitary Examination of Milk and Dairy Products (Medstandart Russia) | The chemical reagents kit for milk and dairy product testing (Medstandart, Russia) contains reagents for determining fat, protein, acidity, acid number, antibiotic residues, and other quality parameters. The reagents are supplied in sealed containers, stable during storage, and suitable for laboratory and field use. | Required for qualitative analysis of milk and dairy products during laboratory analyses. | 30000 | 3 | 90000 | April-December | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР19680287 | Automatic press for mounting metallographic samples МР-3000 | The DTQ-5 model with low cutting speed is suitable for precise cutting of various hard materials, especially for all kinds of small metal, non-metal parts and various electronic components. Specifications: Positioning accuracy: 0.01mm; Rotation speed: 0-700rpm; Blade diameter: Ø100 - 150mm; Power: 220V/110V, 50Hz; Dimensions: 350x350x200mm; Weight: 18.5kg. | As part of the implementation of this project, a study is being conducted on the effect of local electrolytic plasma hardening (EPH) on the structure and properties of steel parts of a freight car bogie. For a detailed analysis of the structure of the hardened layer, it is necessary to conduct metallographic studies that require the preparation of high-quality sections. One of the critical stages of preparation is the precise and accurate cutting of samples from large and hard metal parts. This requires the use of specialized cutting equipment that ensures precision cutting without overheating and deformation of samples. The optimal solution is the DTQ-5 cutting machine, which will allow you to prepare samples with high accuracy, efficiency and safety. | 1 | 1 | 1 | april | 50/50% | Поставлено | |
| АР19680287 | Metallographic grinding and polishing machine LMP-3S | LMP-3S is a multifunctional equipment designed for preparing metallographic samples. It combines preliminary grinding, coarse and fine grinding, as well as coarse and fine polishing. The machine features a powerful motor, low noise level, high reliability and ease of operation, which makes it an ideal choice for industrial enterprises and research organizations. Working disk diameter - 250 mm Working disk speed - 50-1000 rpm (smooth adjustment), fixed speeds: 400/600/800/1000 rpm Direction of rotation - clockwise and counterclockwise Speed of grinding/polished head - 5-10 rpm (smooth adjustment) Number of samples processed simultaneously - 6 pcs. Load range – 0-0.7 MPa (adjustable, factory setting ≤ 0.2 MPa Sample preparation time – 0-3000 seconds Sample diameter – 30 mm Input voltage – single-phase 220 V ± 10%, 50-60 Hz Total power – 900 W Overall dimensions – 790 x 740 x 700 mm Weight (net) - 89.6 kg | The hardened layer after EPU has a complex structure, requiring high-quality surface preparation for correct analysis. The LMP-3S machine allows you to get a perfectly smooth surface without artifacts. The automated grinding and polishing process ensures the same processing parameters for all samples, eliminating the influence of the human factor. Manual sample preparation takes a lot of time and requires highly qualified operators. The LMP-3S significantly speeds up the process due to automatic control of pressure, speed and processing time. | 3 | 1 | 3 | april | 50/50% | Поставлено | |
| АР19680287 | Automatic feeding system for dosing and polishing 2T | The 2T Automatic Polishing Feed System is a device that integrates a precise peristaltic pump, touch screen display and intelligent liquid feed control. The device automatically adjusts the feed intervals and power, ensuring uniform distribution of grinding and polishing suspension in the required volume and at a given speed. Model - 2T Liquid bottle capacity - 500ml*2 Control and display - touch screen Natural motor - DC motor Power - 200V, 50Hz Size - 210x280x260mm | The purchase of the system is justified by the need to improve the accuracy and efficiency of the polishing process for steel parts of a freight car bogie when preparing their surface for analysis after local electrolytic-plasma hardening. Automatic supply of suspensions allows for precise control of the amount and uniformity of application of the polishing material, reducing the likelihood of human error and ensuring process stability. This improves the quality of the final polishing, which is critical for obtaining reliable data in microstructural analysis and assessing the properties of hardened parts. | 540 | 1 | 540 | april | 50/50% | Поставлено | |
| АР19680287 | Medical electric water distiller type AE according to TU 9452-01-22213860-2009 in the version: AE-10/20 (with a built-in water collector) | Production of distilled water of type 3 according to GOST R 58144-2018 ""Distilled water"", FS.2.2.0019.18 ""Water for injection"" Productivity - 10 l / h Volume of water separator - 20 l Cooling water consumption - 75 l / h Source water pressure - 0.1 ... 0.4 MPa Specific conductivity of water at the outlet 2 ... 2.5 μS / cm Temperature of produced water - 24 ... 40 ℃ Power supply - 380 V, 50 Hz Power consumption - 7.2 kW Dimensions - 425x425x775 mm Weight - 22.8 kg Water purification coefficient from radionuclides is not less than 4000 Average service life - 10 years | The project requires distilled water, which is the main component of electrolytes used in the process of local electrolytic-plasma hardening. The new premises do not have a distiller, which complicates the research. The purchase of AE-10/20 is necessary for the uninterrupted conduct of experiments and increasing the efficiency of the laboratory. | 617 | 1 | 617 | april | 50/50% | Поставлено | |
| АР19680287 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Purchase of a monoblock for the material and technical base. | 400000 | 5 | 2000000 | april | 50/50% | В период поставки | |
| АР19680287 | Flat Corrosion Cell CS936 | The CS936 flat corrosion cell is designed for electrochemical corrosion studies on flat samples. It provides a working area of 1 cm² and can be equipped with a jacket for water circulation, which allows temperature control during experiments. The kit includes: Reference electrode Ag/AgCl Counter electrode: platinum mesh 20x20 mm This cell is compatible with various electrochemical instruments and is suitable for accurate and reliable measurements in the field of corrosion studies. | To study the corrosion resistance of hardened parts, the project requires electrochemical testing. Under current conditions, sample preparation takes a significant amount of time: it is necessary to make contact and coat the surface with varnish. Simplification of work - the sample is simply installed in the cell without additional preparation. Standard contact conditions ensure reproducibility of results. Reduction of time costs - accelerates the research process, improving their efficiency. Purchase of CS936 will optimize corrosion tests, reduce preparation time and improve the quality of results. | 350 | 1 | 350 | april | 50/50% | Поставлено | |
| АР19680287 | Analytical laboratory scales ADAM HCB | Maximum weighing capacity (MWC), g: 120 Readability, g: 0.001 Dimensions (W×D×H), mm: 172×251×75 Weight, kg: 2 | The project requires high-precision equipment to carry out accurate measurements of sample mass. ADAM HCB analytical laboratory scales will provide the necessary accuracy and stability in measurements, which is critical for the correctness of all experimental data. | 340 | 1 | 340 | april | 50/50% | Поставлено | |
| АР19680287 | Sanding paper | Diameter: 250 mm Grit size: 100–2500 | The sample preparation for this project requires the use of abrasive papers with different grits to ensure the required surface quality for subsequent metallographic analysis. Different paper grits allow for efficient grinding at different stages of sample preparation, from rough grinding to final polishing. | 580 | 1 | 580 | april | 50/50% | Поставлено | |
| АР19680287 | Epoxy resin for embedding samples | Epoxy resin for embedding samples for SEM | To prepare samples of steel parts of a freight car bogie subjected to local electrolytic-plasma hardening, epoxy resin is required for their pressing before conducting metallographic analysis. This will ensure stability and convenience during processing and research. Epoxy resin has excellent adhesion and strength, which guarantees reliable fixation of samples and their protection from damage during grinding and polishing. | 210 | 1 | 210 | april | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР19579513 | Automatic press for mounting metallographic samples MP-3000 | Mold diameter – 30 mm Parameter programming – programmable database, up to 99 assembly methods maximum number of samples – 2 pcs. per cycle Heater power – 2000 W Temperature range – 0-200℃ (adjustable) Heating time range – 0-30 minutes Pressure range 0-6 MPa (adjustable) Total assembly time – 6 min Pressure mode – automatic (electro-hydraulic system) Cooling system – automatic water cooling Control type and display – 7-inch touch screen Operating mode – automatic/manual Power consumption – 2200 W Power supply – AC 220V, 50Hz Dimensions/weight – 630x520x480 mm, 120 kg | The project includes a study of the structure and properties of surface-hardened stainless steel parts. This requires metallographic analysis, which requires the preparation of high-quality sections. One of the key stages of preparation is the installation of samples in polymer molds, which ensures the convenience of their subsequent processing and analysis. | 4401140 | 1 | 4401140 | april | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23488875 | Monoblock | 27" Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional | Procurement of all-in-one computers for the establishment of an academic writing center | 569000 | 1 | 569000 | may | 100% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP23488216 | Magnetic stirrer | Asynchronous/Synchronous control mode. The maximum volume is 6 500 ml places. Max. temperature is 120 ℃. The mixing speed is from 50 to 1200 rpm. The size of the platform for 1 seat is 110 mm. Dimensions 430*220*65 mm. Weight 6.5 kg. The manufacturer is China. | Mixing solutions and suspensions during scheduled experiments. | 791828 | 1 | 791828 | September | 50/50% | В период поставки | |
| AP23488216 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Purchase of a monoblock for the material and technical base | 400000 | 1 | 400000 | may | 50/50% | В период поставки | |
| AP23488216 | Multifunctional copier Canon i-Sensys MF-463dw | Print Type: Monochrome Supported Print Formats: A4, A5, A6, B5, C5, DL (ISO) Minimum Paper Weight, g/m², from: 60 Maximum Paper Weight, g/m², up to: 120 Maximum Print Resolution, DPI: 1200 x 1200 Maximum Black & White Print Speed, pages/min, up to: 40 Recommended Monthly Load, pages/month, up to: 4000 Scanner Resolution, DPI: 600 x 600 Input Tray Capacity: 50 sheets, 100 sheets, 250 sheets Output Tray Capacity: 150 sheets Features: Automatic Duplex Printing, USB Printing, Apple AirPrint | Purchase of a multifunctional copier for the material and technical base | 250000 | 1 | 250000 | May | 50/50% | В период поставки | |
| AP23488216 | Scanner | Scanner | Purchase of a scanner for the material and technical base | 75000 | 1 | 75000 | may | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24992870 | Ion-plasma nitriding plant BYLXH-30GZD10RB | Auxilixry heating function is available Working temperature <900℃ Effective working dimensions of vacuum furnace - 300 mm×400 mm Ultimate vacuum degree - <6.67 Pa Pressure increase rate - <0. 13pa/min Evacuation time up to 20Pa - <30min Rated load - about 35 kg Standard nitriding area 60000 cm² Power of auxiliary heating 10KW" | To increase the service life and reliability of shut-off and control valve parts, it is necessary to develop ion-plasma nitriding technology. This method improves wear resistance, corrosion resistance and mechanical strength of parts, which is especially important for increasing the reliability and durability of equipment in mechanical engineering and power engineering. The purchase of the installation will allow the implementation of research and industrial tasks of the project, optimize technological processes and reduce costs for importing similar products. | 29 | 1 | 29 | may | 50/50% | Поставлено | |
| BR24992870 | Sormaite powder | Wear-resistant surfacing material used to strengthen and restore parts operating under conditions of increased wear and impact loads. It is a powder mixture based on iron with carbides, alloying elements (e.g. chromium, nickel, molybdenum) and other components that provide high hardness and wear resistance. 200 kg | Sormait is a highly wear-resistant material used to strengthen the working surfaces of parts subject to intense mechanical impact. Its use can significantly increase the service life of equipment and reduce the cost of repair and replacement of worn-out elements. The use of this powder in sprayed coatings will provide additional protection against abrasive wear and corrosion. | 200 | 1 | 200 | may | 50/50% | В период поставки | |
| BR24992870 | Gas (nitrogen, hydrogen, oxygen) with cylinder | Nitrogen (N₂) Inert gas, prevents oxidation of metals Hydrogen (H₂) Reducing gas, prevents formation of oxides Oxygen (O₂) Oxidizer, used in oxygen-fuel spraying. Gases in cylinders" | Nitrogen is used in ion-plasma nitriding processes, helping to strengthen metal parts and increase their wear resistance. Hydrogen is used in reduction processes, improving the quality of metal coatings and preventing their oxidation. Oxygen is necessary for high-speed oxygen-fuel spraying, providing high temperature and density of protective layers. | 4 | 1 | 4 | may | 50/50% | В период поставки | |
| BR24992870 | Powders (Zr-Y-O, Cr₃C₂-NiCr, NiCr, Ta, WC-Co-Cr, WC-Co, Al₂O₃, Al, Cr₂O₃) | 33 kg | The purchase of these powders is necessary for the development and application of protective coatings using high-speed oxygen-fuel spraying and ion-plasma deposition. They provide increased wear resistance, corrosion and thermal resistance of machine-building parts and military equipment. The use of these materials will extend the service life of equipment and improve its performance characteristics. | 33 | 1 | 33 | may | 50/50% | Поставлено | |
| BR24992870 | Low power pump | Type: Submersible Operation Type: Lifting Flow Type: Circulating Power: 35.0 W Max Head (Lift Height): 240.0 cm Dimensions: 106×75×96 mm Weight: 775.0 g | Оборудование необходимо для реализации проекта. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | PVC pipes 100mm | Pipe Material: PVC Pipe Type: Smooth Application Area: Water supply, sewage Outer Diameter: 100.0 mm Pipe Length: 2.0 m Maximum Pressure: PN 6 Wall Thickness: 2.2 mm Color: White | Equipment is necessary to implement the project. | 20 | 1 | 20 | may | 100% | Поставлено | |
| BR24992870 | DTS sensor | Technical Specifications TDS Signal Adapter Board: - Input Voltage: 3.3 ~ 5.5 V - Output Signal: 0 ~ 2.3 V - Operating Current: 3 ~ 6 mA - TDS Measurement Range: 0 ~ 1000 ppm - TDS Accuracy: ±10% F.S. (25°C) - Size: 42 × 32 mm - Module Interface: XH2.54-3P - Electrode Interface: XH2.54-2P TDS Sensor: - Number of Sensors: 2 - Total Length: 83 cm - Connection Interface: XH2.54-2P - Color: White - Other: Waterproof sensor Package Includes: - 1 × TDS Signal Adapter Board - 1 × Waterproof TDS Sensor - 1 × Analog Sensor Cable Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209 | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | PH sensor | Amplifier Board: Power Supply Voltage: 5±0.2 V Operating Current: 5–10 mA Operating Temperature: -10…50 °C Service Life: 3 years Dimensions: 42 mm × 32 mm × 20 mm Weight: 25 g pH Sensor: pH Range: 0–14 pH Measured Solution Temperature Range: 0–60 °C Zero Point: 7 ± 0.5 pH Response Time: ≦1 min BNC Connector Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209 | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Temperature sensor | Technical Specifications: Type: NTC Thermistor Resistance: 10 kΩ (at 25°C) B-constant: 3380K ±1% Peak Voltage: AC 1800V (1 mA, 2 sec) Dissipation Power: 5 mW/°C Probe Insulation: >100 MΩ Measurement Range: -20…+105°C (accuracy decreases below -20°C) Probe Diameter: 5 mm Probe Length: 25 mm Cable Length: 1 m Casing Material: Stainless Steel Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209 | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Water level sensor | Sensor Material: Stainless Steel Cable Length: Approx. 30 cm Float Diameter: 28 mm Float Height: 28 mm Sensor Length (without wires): 100 mm Mounting Thread: M10 Operating Temperature: -30 ℃ ~ +125 ℃ Color: Silver Contact Voltage: AC/DC 100V (max 220V) Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209 | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Arduino Kit | Arduino Mega 2560 R3 Microcontroller: ATmega2560 Clock Speed: 16 MHz Flash Memory: 256 KB SRAM: 8 KB EEPROM: 4 KB Logic Level Voltage: 5 V Input Supply Voltage: 7–12 V Maximum 5V Pin Output Current: 1 A | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Aluminum X-shaped profile | Dimensions: 40×40 mm Slot Width: 10 mm Coating: Anodized layer Weight: Approx. 1.62 kg/m Design: Special cross-section designed to increase resistance to bending and torsion | Equipment is necessary to implement the project. | 100 | 1 | 100 | may | 100% | Поставлено | |
| BR24992870 | 100мм Elbow for PVC pipe 100mm | Type: Elbow Pipe Diameter: 100.0 mm Angle: 90.0° Dimensions: 100 Color: White Material: Polypropylene | Equipment is necessary to implement the project. | 40 | 1 | 40 | may | 100% | Поставлено | |
| BR24992870 | Corner for fixing aluminum profile | astener Type Included: Mounting bracket (angle) Purpose: For installation, For aluminum Length: 20 mm Width: 20 mm Material: Aluminum Color: Gray | Equipment is necessary to implement the project. | 40 | 1 | 40 | may | 100% | Поставлено | |
| BR24992870 | PVC coupling 100mm | Equipment is necessary to implement the project. | Type: Coupling Pipe Diameter: 100.0 mm Dimensions: 100 Material: Polypropylene | 20 | 1 | 20 | may | 100% | Поставлено | |
| BR24992870 | Cable | Type of Cable Product: Cable Cable Type: Household, Power Marking: PVS Number of Cores: 2 Cross-Section: 2.5 mm² Length: 1.0 m Conductor Material: Copper Application: Indoor, Outdoor Sheath Material: PVC compound Insulation Material: PVC | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Container 30l | Type: Container Shape: Rectangular Material: Plastic Lid: Included Handles: Included Width: 390 mm Length: 620 mm Height: 190 mm Volume: 30 L | Equipment is necessary to implement the project. | 30 | 1 | 30 | may | 100% | Поставлено | |
| BR24992870 | Seedling cups | Type: Pot Purpose: For seedlings Material: Plastic Shape: Round Color: Black Drainage Holes: Yes Size: 45×55 mm | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | power unit | Compatibility: For video surveillance, LED strips, power supply Device Type: Power supply unit Voltage: 12V Dimensions: 19 x 9 x 4 cm Operating Temperature: -10°C ~ +60°C | Equipment is necessary to implement the project. | 100 | 1 | 100 | may | 100% | Поставлено | |
| BR24992870 | Tube 8 mm | Net Weight: 0.583 kg Tube Diameter: 8 mm Hose Length: 25 m Tube Material: PVC | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Bolts nuts | Type: Bolt Length: 35 mm Diameter: 6 mm Set Includes: Bolt, nut, washer | Equipment is necessary to implement the project. | 20 | 1 | 20 | may | 100% | Поставлено | |
| BR24992870 | Ultraviolet lamp | Base Type: No base Lamp Type: Ultraviolet Number of Light Sources: 96 Power of Light Source: 100 W Luminous Flux: 16,000 lm Color Temperature: 16,000 K Mounting Type: Pendant Material: Aluminum Dimensions: 12 x 23 cm Color: Black | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Extension cord | USB Port: Yes Light Indicator: Yes Cable Length: 2.0 m Dimensions (W×H×D): 170 × 100 mm Built-in Charging Ports for Phones and Gadgets: 4× USB, 2× Type-C Type: Power strip Number of Sockets: 3 Socket Type: Type C (Euro standard with grounding) Input Voltage: 220.0 V Rated Current: 10.0 A Color: Black | Equipment is necessary to implement the project. | 10 | 1 | 10 | may | 100% | Поставлено | |
| BR24992870 | Automatic screwdriver | Impact Function: No Functions: Reverse, Drilling Package Includes: Case Battery Voltage: 20.0 V Battery Type: Li-Ion Battery Capacity: 2.0 Ah Battery Charging Time: 1.0 hour Power Supply: Battery-powered Battery and Charger Included: Yes Chuck Type: Keyless Tool Type: Drill-driver Number of Speeds: 2 Chuck Diameter: 10 mm Max No-load Speed: 1400 rpm Max Torque: 45.0 Nm | Equipment is necessary to implement the project. | 2 | 1 | 2 | may | 100% | Поставлено | |
| BR24992870 | Soldering iron | Material (Handle): Plastic Dimensions: 26×15×5 cm Set Includes: Soldering iron; 5 tips; rosin; stand; desoldering pump; sponge; solder wire; wire stripper; 2 jumper wires; 2 tweezers; 6 hooks; screwdriver with 5 bits Additional Info: Comes in a carrying bag Type: Soldering Iron Power: 60.0 W Power Adjustment: Smooth (stepless) Power Supply: AC mains Input Voltage: 220 V Soldering Station Features: Adjustable temperature Model/Item Code: SIK008 (26 items) Heater Type: Ceramic Min. Heating Temperature: 200.0 °C Max. Heating Temperature: 450.0 °C Temperature Stabilization: Yes Tip Material: Copper with coating | Equipment is necessary to implement the project. | 2 | 1 | 2 | may | 100% | Поставлено | |
| BR24992870 | Roller pipe cutter 100 mm | Pipe Cutter Type: Roller Type: Pipe Cutter Compatible Pipe Types: Metal-plastic, PVC, HDPE, polypropylene, PEX, CPVC Drive Type: Manual Max Diameter: 110.0 mm Power Supply: None (manual operation) | Equipment is necessary to implement the project. | 2 | 1 | 2 | may | 100% | Поставлено | |
| BR24992870 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Purchase of a monoblock for the material and technical base. | 400000 | 2 | 800000 | may | 50/50% | Поставлено | |
| BR24992870 | Laptop | Screen Diagonal screen: 16.0 inches Screen resolution: 2560x1600 2.5K Screen refresh rate: 240 Hz Screen brightness: 500.0 cd/m2 Screen coating: matte Touch screen: no Matrix type: IPS Processor Maximum processor frequency: 4900.0 MHz Processor: Intel Core i7-13650HX Base frequency of the processor: 2600.0 MHz Number of processor cores: 14 cores Cache size: L324 MB memory RAM size: 16.0 Gb Memory type: DDR5 Memory frequency: 4800.0 MHz Maximum memory size: 32.0 Gb Number of memory slots: 2 Storage device Hard disk type: SSD Total storage volume: 1000.0 Gb Storage interface: SSD Video Type of video adapter: discrete and integrated video card Video card: NVIDIA GeForce RTX 4060 + Intel UHD Graphics Video memory type: GDDR6 Video memory size: 8192.0 Mb Wireless communication and connection Standard Wi-Fi 802.11ax Bluetooth version: 5.3 Network card built-in network card, 1000 Mbit/c Number of interfaces USB 3.12 Interface: Thunderbolt 4, USB 3.2 Gen1 Type-A, USB 3.2 Gen2 Type-C Input: microphone/headphone combo Outputs: HDMI, RJ-45 Sound and input devices: Sound 2 speakers with the technology of intelligent amplification Smart AMP Positioning devices: NumberPad Backlit keyboard: Yes Keyboard layout: Russian, English Features and additional information Camera Resolution: 720p HD Additional information Technology NVIDIA Advanced Optimus Display ROG Nebula Response time 3 ms Color gamut DCI-P3 100% Support for technologies Dolby Vision HDR and Dolby Atmos 2 dynamics with technology of intelligent amplification Smart AMP Certification Hi-Res Technology of intellectual noise reduction Nutrition Battery: 80-90 Wh Weight 2.6 kg | Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop. | 1200000 | 1 | 1200000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Laptop | Display Screen Size: 14.0 inches Resolution: 1920 x 1200 WUXGA Refresh Rate: 60 Hz Screen Brightness: 400.0 cd/m² Screen Coating: Glossy Display Type: OLED Processor Maximum Processor Frequency: 4500.0 MHz Processor: Intel Core Ultra 5 125H Base Processor Frequency: 1200.0 MHz Number of Processor Cores: 14 Cores Cache Size: L318 MB Memory RAM Size: 16.0 GB Memory Type: LPDDR5X Memory Frequency: 7467.0 MHz Storage Devices Hard Drive Type: SSD Total Storage Capacity: 512.0 GB Flash Card Reader: Yes Video Video Adapter Type: Integrated graphics Graphics: Intel Arc Graphics Wireless and Connectivity Standard: Wi-Fi 802.11ax Bluetooth Version: 5.2 Number of Interfaces: USB 3.02 Interfaces: USB Type-C Sound: Front-facing speakers: 2 W x 2 Keyboard Backlight: Yes Keyboard Layout: Russian, English Features and Additional Information Camera: Infrared camera, physical shutter on the camera, 1080p FHD resolution Power Battery: Up to 57 Wh Weight and Dimensions | Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop. | 690000 | 1 | 690000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Cold rolled sheet 3x1250x2500 mm 12X18N10T GOST 5582-75 GOST 19904-90 (2р), Circle Ø25 12Х18Н10Т L= 2-6m GOST 5949 2018 GOST 2590 (20р) | Product type: Cold rolled sheet (CR) Dimensions: thickness – 3 mm, width – 1250 mm, length – 2500 mm Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5582-75 (for steel), 19904-90 (for sheet metal) Surface condition: cold rolled, polished/uncoate Material density: ~7.9 g/cm³ Weight of 1 sheet: ~74 kg (estimated: 3 mm × 1.25 m × 2.5 m × 7.9 t/m³) Product type: round rolled products (circle) Diameter: Ø25mm Length: 2–6m Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5949‑2018 (for stainless steel), 2590 (for hot-rolled products) Condition: hot-rolled or calibrated | Cold-rolled sheet 3×1250×2500mm made of 12X18N10T steel will be used to manufacture experimental samples and parts as part of the project. The material is necessary for conducting a series of studies on the application and testing of coatings, since its characteristics will ensure the correctness and reproducibility of the experimental results. The Ø25mm circle made of 12X18N10T steel will be used to manufacture experimental blanks and parts required for conducting research within the framework of the project. The material will provide stable mechanical and corrosion properties, which will allow obtaining correct and reproducible test results. | 859874 | 1 | 859874 | August-October | 50/50 | В период поставки | |
| BR24992870 | Рowders for plasma surfacing | Stellite 12 Powder (Co-30Cr-8W-3Ni-2Fe-1.4C-1-2%Si-<1%Mn, 53-150 μm) 2x69 750=139 500 Stellite 21 Powder (27Cr–5.5Mo–2.8Ni–1.5Fe–1Si–0.25C, 53-150 μm) 2x69 750=139 500 Stellite 190 Powder (30Cr–12.5W–1.1Si–1.4C, 53-150 μm) 2x61 875=123 750 Deloro 56 Powder (<0.6C–17Cr–2.5Mo–4.5Si–3.6B–3Fe–2.5Cu, 53-150 μm) 2x70 000= 140 000 Deloro 60 powder (~0.7C–15Cr–4.4Si–3.1B–<4Fe, 53-150 μm) 2x70 000= 140 000 PS-12NVK-01 Powder 65% PG-10N-01 + 35% WC, 53-150 μm 2x75 000= 150 000 PR-7Kh5M4FGBR powder 53-150 μm 2x65 000= 130 000 High carbon, high chromium iron powder based powder (C 3.9%, Cr 26%, Si 1.5%, Ni 1.7%, W 0.3%, Mo 0.1%, Mn 1.1%, 53-150 μm) 2x60 000=120 000 Powder WC-20Ni (Tungsten carbide with nickel powder) (WC ~80%, Ni ~20%, 53-150 μm) 2x88 875= 177 750 Powder Co-Cr-W-Ni-Fe alloy powder (Co-Cr-W-Ni-Fe alloy powder, 53-150 μm) 2x101 250 = 202 500 Powder Ni-B-Si-Fe alloy with added tungsten carbides (Ni-B-Si-Fe alloy with added tungsten carbides, 53-150 μm) 2x72 000= 144 000 | The powders specified will be used for plasma surfacing work within the framework of the project plan. Their chemical composition and dispersion will ensure the production of coatings with various physical, mechanical and corrosion-resistant properties, which is necessary for comparative studies and the selection of optimal application modes. | 1610000 | 1 | 1610000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Diamond cutting disc 110*20*1.0 mm, Metal cutting band saw 164*13*8/12 | for cutting hard materials 5x32 000=160 000, bi-metal, tooth pitch 8/12TPI 5x25 000=125 000 | Their availability is necessary for sample preparation and assembly, surfacing, automatic and manual welding, and subsequent mechanical processing. The purchase of these consumables and equipment will ensure the smooth execution of technological operations and compliance with the project implementation deadlines. | 285000 | 1 | 285000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Ammonia anhydrous liquefied with a reducer | Ammonia grade A, 40 l, reducer model: BAMO-1.21 (version 09) TU 26-05-25-84 | A supply of process ammonia (NH₃) in cylinders is required, along with a two-stage pressure reducer (pressure regulator) and a safety kit to ensure stable, reproducible and safe operation of the ion-plasma nitriding (IPN) unit. | 1325000 | 1 | 1325000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Laboratory and technological equipment, consumables and components | 9.1-inch 4K monochrome LCD display - 1 pc (143,000) CCT-3320T conductivity monitor with CON-1134-13 conductivity sensor - 1 pc (33,600) MARK-902/1 pH meter - 1 pc (1,147,200) GP-902/1 Hydraulic panel for the MARK 902 BP31.07.000-01 device - 1 pc (345,000) BP31.02.700 flow-through cuvette - 1 pc (212,000) Single-channel compressor - 1 pc (5,800) 8x3.5 cm air pump - 1 pc (9,500) M5 carbon steel T-nuts, 3030, 50 pcs/pack - 3 pack (24,600) 3030-6 Aluminum Corner Brackets, 10 pcs/pack - 3 packs (20,700) 3030 Aluminum Profile, 1200 mm, 6 pcs/pack - 1 pack (24,500) 3030 Aluminum Profile, 900 mm, 20 pcs/pack - 1 pack (61,800) FD-100 Electric Exhaust Fan - 1 pc (25,900) T.XA-420-Kl1-1-8 Temperature Sensor 300-(0/+300°C) - 1 pc (65,500) DN-300 Vikhr Drainage Pump - 2 pcs (50,000) Dielectric Mat, 750*750 mm - 1 pc (6 800) | A set of equipment, instruments and consumables is necessary for equipping and modernizing the experimental installation, which is used in the framework of studies on the development and optimization of technological processes of surface treatment by ion-plasma and electrochemical methods. Ensuring the possibility of conducting accurate, reproducible experiments related to the control of physical and chemical parameters of the environment, as well as stable operation of auxiliary systems of the installation (gas, liquid, ventilation and measuring). | 2176300 | 1 | 2176300 | August-October | 50/50 | В период поставки | |
| BR24992870 | A service for conducting research on the elemental-phase composition and tribological properties of samples | Determination of the elemental phase composition of coatings (number of samples: 50). The elemental composition of the coatings was determined using energy-dispersive X-ray spectroscopy (EDS) on a scanning electron microscope (SEM) in secondary (SE) and backscattered electron (BSE) modes. For each sample, the elemental distribution across the cross-section was analyzed using linear analysis and elemental mapping covering the coating/substrate interface. Micrographs of the cross-section were also obtained at various magnifications (at least 3 magnified images). Result: SEM images, EDS spectra, and quantitative analysis of the elemental content. The phase composition was determined by X-ray diffractometry. Shooting modes: diffraction angle 20-90 degrees; shooting step 0.02 degrees; exposure time 0.5 seconds. Result: diffraction pattern without decoding and data in electronic format with a .txt file extension. 2.2 Study of the tribological properties of the coatings (number of specimens: 50). Tribological tests shall be carried out using the ball-on-disc method in accordance with ASTM G99. Test parameters: counterbody - steel ball; ball diameter 3-6 mm; load not less than 5 N; rotation speed not less than 0.02 m/s; track radius not less than 2 mm; track length not less than 60 m. Tests shall be carried out in dry friction mode at room temperature. After the ball-on-disc friction test, determine the wear rate and area using profilometry in accordance with ISO 13565. Result: graphs of the friction coefficient versus friction distance in PDF format, wear rate and area, as well as these graphs of the friction coefficient versus friction distance in electronic format (file extension txt). Test specimens for abrasive wear in accordance with GOST 23.208-79 "Unified Testing System." Method for Determining Abrasive Wear. Tests must be conducted using appropriate equipment under controlled conditions, with all parameters influencing the results (load, type of abrasive, sample weight before and after testing, etc.) recorded. Result: a brief description of the test methodology and presentation of the obtained data in tabular form. | Conducting a comprehensive study of the elemental-phase composition and tribological properties of coatings on the surface of stainless steels and heat-resistant nickel alloys obtained by plasma surfacing and thermal spraying, as well as samples after treatment by ion-plasma nitriding. | 3900000 | 1 | 3900000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Welding materials, equipment and tools for welding and grinding works | MP-3 ARS Electrodes, 3mm Diameter, 2.5kg Pack (5kg) - 9,400 MP-3 ARS Electrodes, 5mm Diameter, 5kg Pack (10kg) - 18,600 309LSI Stainless Steel Wire, 1.2mm Diameter (5kg) - 41,000 LC1230N Metal Cutting Saw (1pc) - 397,060 SV-08G2S Welding Wire, 1.2mm Diameter (18 pcs) - 26,406 AG-125 SGM Angle Grinder (1pc) - 22,230 AIR-25 Compressor (24L, 206L/min input, 1.5 kW, 220V)/Aurora (1pc) - 88,350 Welding mask "Chameleon" A777c (9-13DIN) KAZAKHSTAN (3 pcs) - 26,300 Aluminum wire ER5356, 1.2 mm dia. (5 kg) - 30,000 Electrode holder DE 2300 (512.D070) (1 pc) - 12,950 Welding hammer with spring handle (1 pc) - 1,700 Cutting wheel 125 x 1.6 x 22 mm A646R (340946) (10 pcs) - 8,250 Cutting wheel 150 x 1.6 x 22 mm A46TZ Special (241472) (10 pcs) - 12,000 3M™ reusable half mask, size M, model 6200 (3 pcs) - 23,700 | The procurement of a complete welding equipment set, materials, and accessories is necessary for welding, cutting, and grinding operations during the fabrication, assembly, and repair of experimental prototypes, as well as for the preparation and processing of metal structures for experimental research and process debugging. This ensures the ability to perform high-quality and safe welding and metalworking operations during the preparation of parts and assemblies used in experimental and production work. | 775000 | 1 | 775000 | August-October | 50/50 | В период поставки | |
| BR24992870 | Stegler HS-Pro Digital Stirrer (HS-Pro Digital Magnetic Stirrer with Heating) | The Stegler HS-Pro Digital Magnetic Stirrer with Heating is a modern laboratory instrument designed for the simultaneous stirring and heating of liquid media. It features digital controls and an LCD display showing the actual and set temperature and speed values. The speed range is 200–1500 rpm, allowing the stirrer to be used with solutions of varying viscosities. The maximum stirred volume is 20 liters (for water). The heating temperature is adjustable up to 380°C, ensuring reactions requiring high temperatures. The working surface is made of aluminum with a 150×150 mm ceramic coating that is chemically resistant and distributes heat evenly. The heater output is approximately 500 W, and the power supply is 220 V, 50 Hz. The device features overheating protection (automatic shutdown at temperatures above 400°C) and a hot surface indicator. The dimensions of the mixer are approximately 170×320×105 mm, weight is about 2.7 kg. | The Stegler HS-Pro Digital combines high heating power, a wide speed range, and convenient digital control, making it ideal for laboratory work involving solution preparation, chemical syntheses, and temperature-sensitive reactions. The ceramic work surface is resistant to aggressive reagents, ensures uniform heating, and a safety system enhances operational safety. Precise temperature and speed control ensure consistent parameters, which is especially important for reproducible experimental studies. | 135000 | 1 | 135000 | 50/50 | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP22683114 | Potato | Reproduction: Elite and/or first reproduction Diameter: 40–50 mm Net weight: 6t | For experiments | 2 | 1 | 2 | april | 100% | Поставлено | |
| AP22683114 | Fertilizer | Fertilizer | For experiments | 479 | 1 | 479 | april | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP19178510 | Monoblock PC | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Purchase of a monoblock for the material and technical base. | 400000 | 1 | 400000 | September | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP19175164 | Scientific research service | Publishing monographs | The publication of monographs is an important tool for disseminating, consolidating and developing scientific knowledge obtained within the framework of the project | 2300 | 100 | 230000 | november | 50/50% | В период поставки | |
| AP19175164 | Monoblock Acer Aspire C24-2G | Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black | Purchase of a monoblock for the material and technical base. | 425300 | 2 | 850600 | april | 50/50% | Поставлено | |
| AP19175164 | Scientific research service | Purchase of stationery | for the implementation of the project and the preparation of the final report | 53010 | 1 | 53010 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP22684076 | Laboratory centrifuge | Laboratory centrifuge | Research within the project | 803 | 1 | 803 | may | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software | Whey protein concentrate – 2 pieces | To provide an experiment. | 40 | 1 | 40 | April | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software | Cold pressed cedar oil (Katon-Karagay) - 0.5 l | To provide an experiment. | 30 | 1 | 30 | April | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software | Supergel 1000 (Carrageenan) - 2 pcs. | To provide an experiment. | 20 | 1 | 20 | april | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software" | Beef 1 category - 30 kg | To provide an experiment. | 90 | 1 | 90 | april | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software" | Horse meat, 1st grade – 30 kg" | To provide an experiment. | 105 | 1 | 105 | april | 100% | В период поставки | |
| AP22684076 | Procurement of materials, equipment, and/or software | 50 ml volumetric flask – 6 pieces" | To provide an experiment. | 12 | 1 | 12 | april | 100% | Поставлено | |
| AP22684076 | Procurement of materials, equipment, and/or software | Artificial sausage casing – 4 pieces | To provide an experiment. | 10 | 1 | 10 | April | 100% | Поставлено | |
| AP22684076 | Procurement of materials, equipment, and/or software | Spice and seasoning mix – 3 pieces | To provide an experiment. | 8 | 1 | 8 | April | 100% | Поставлено | |
| AP22684076 | Scientific research service | Laboratory services for determination of fatty acid composition | To provide an experiment. | 20000 | 3 | 60000 | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР22688434 | Scientific research service | Memories of Alash (working title) | Research within the project | 1 | 1 | 1 | may | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP22686900 | Biological microscope with camera | Biological microscope with camera | Equipment is necessary to implement the project. | 1386841 | 1 | 1386841 | may | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP22686708 | Scientific research service | Publishing monographs | The publication of monographs is an important tool for disseminating, consolidating and developing scientific knowledge obtained within the framework of the project." | 2250 | 100 | 225000 | june | 100% | В период поставки | |
| AP22686708 | Scientific research service | Laboratory services for determination of organoleptic indicators, heavy metals, minerals | Research within the project | 134682 | 1 | 134682 | may | 100% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| AP22685400 | Scientific research service | Service for the development and manufacture of a prototype device "Endoviovaginoscope for cows and sheep" | The service is necessary to complete the project. | 1300000 | 1 | 1300000 | april | 100% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24992940 | "Whole Genome Sequencing of Sheep Progeny Obtained by Interbreeding" | Whole genome sequencing of sheep progeny obtained by interbreeding 97 sheep | In pursuance of the calendar plan items | 19 | 1 | 19 | 50/50% | Поставлено | ||
| BR24992940 | Bioinformatics analysis of molecular genetic research data | Bioinformatics analysis of molecular genetic research data | In pursuance of the research plan items | 5 | 1 | 5 | 50/50% | Поставлено | ||
| BR24992940 | PureLink™ Genomic DNA Isolation Kit, 250 isolates (K182002) | PureLink™ Genomic DNA Isolation Kit, 250 isolates (K182002) | DNA Isolation Kit | 713384 | 1 | 713384 | 50/50% | Поставлено | ||
| BR24992940 | 1.5 ml low adhesive tubes 250 pcs/pack (90410) | 5 packs 1.5 ml low adhesive tubes 250 pcs/pack | 5 packs 1.5 ml low adhesive tubes 250 pcs/pack | 126435 | 1 | 126435 | 50/50% | Поставлено | ||
| BR24992940 | 2-Propanol EMPLURA® | 79800 | 1 | 79800 | 50/50% | Поставлено | ||||
| BR24992940 | Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China) | Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China) 5 packs | Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China) 5 packs | 13775 | 1 | 13775 | 50/50% | Поставлено | ||
| BR24992940 | Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs) | Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs) 5 packs | Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs) 5 packs | 27360 | 1 | 27360 | 50/50% | Поставлено | ||
| BR24992940 | Tips 1000mkl universal (sterile) (pack=1000pcs) (China | Tips 1000mkl universal (sterile) (pack=1000pcs) (China 5 packs | Tips 1000mkl universal (sterile) (pack=1000pcs) (China 5 packs | 12825 | 1 | 12825 | 50/50% | Поставлено | ||
| BR24992940 | Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs) | Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs) 5 packs | Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs) 5 packs | 9100 | 1 | 9100 | 50/50% | Поставлено | ||
| BR24992940 | Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;) | 10 pieces Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;) | 10 pieces Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;) | 20000 | 1 | 20000 | 50/50% | Поставлено | ||
| BR24992940 | Parafilm | Parafilm (Paraffin Sealing Film) (100 mm*38000mm. Material: primarily composed of polyolefins and paraffin waxes offering good resistance against acids, alkalis and some organic solvents;62-0010;Biologix;Пленка парафилм, размеры 100 мм х 38 м. Рекомендуемая температура:-80~90 С. Максимальная длина растяжения: эластичность (25°C):400%. Материал: в основном состоит из полиолефинов и парафиновых восков, обеспечивающих хорошую устойчивость к кислотам, щелочам и некоторым органическим растворителям) - 5 pieces | Parafilm (Paraffin Sealing Film) (100 mm*38000mm. Material: primarily composed of polyolefins and paraffin waxes offering good resistance against acids, alkalis and some organic solvents;62-0010;Biologix;Пленка парафилм, размеры 100 мм х 38 м. Рекомендуемая температура:-80~90 С. Максимальная длина растяжения: эластичность (25°C):400%. Материал: в основном состоит из полиолефинов и парафиновых восков, обеспечивающих хорошую устойчивость к кислотам, щелочам и некоторым органическим растворителям) | 166500 | 1 | 166500 | 50/50% | Поставлено | ||
| BR24992940 | Polyethylene Bags | Polyethylene Bags (Полиэтиленовые пакеты, идеально подходят для хранения образцов, 1000 шт/уп) (4 x 6 inch, Thickness: 4 mil, Case of 1000 (10.16х15,24 см). Идеально подходят для образцов, требующих постоянной герметичности, особенно если образцы будут храниться в течение длительного периода времени;EF28271E (28-6-618);Daigger) 10 packs | Polyethylene Bags (Полиэтиленовые пакеты, идеально подходят для хранения образцов, 1000 шт/уп) (4 x 6 inch, Thickness: 4 mil, Case of 1000 (10.16х15,24 см). Идеально подходят для образцов, требующих постоянной герметичности, особенно если образцы будут храниться в течение длительного периода времени;EF28271E (28-6-618);Daigger) | 20000 | 1 | 20000 | 50/50% | Поставлено | ||
| BR24992940 | Центрифужные пробирки, амбер (темный цвет), с закручивающейся крышкой, ПП, объем 50 мл, 30 x 120 мм, нестерильные, плоское дно | Centrifuge tubes - screw cap - P.P - 15 ml - produced in ASEPTIC (sterile) conditions “Sterile A” (Центрифужные пробирки, амбер (темный цвет), с закручивающейся крышкой, ПП, объем 50 мл, 30 x 120 мм, нестерильные, плоское дно, 20 штук в упаковке;078.12.005;Isolab, Германия) 10 packs | Centrifuge tubes - screw cap - P.P - 15 ml - produced in ASEPTIC (sterile) conditions “Sterile A” | 30000 | 1 | 30000 | 50/50% | Поставлено | ||
| BR24992940 | 50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C. | 50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C. 10 packs | 50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C. | 50000 | 1 | 50000 | 50/50% | Поставлено | ||
| BR24992940 | Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000 | Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000 | Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000 | 40768 | 1 | 40768 | 50/50% | Поставлено | ||
| BR24992940 | CTAB ≥99 %, 100 g, Roth Carl, 9161.1" | CTAB ≥99 %, 100 g, Roth Carl, 9161.1" | CTAB ≥99 %, 100 g, Roth Carl, 9161.1" | 32368 | 1 | 32368 | 50/50% | Поставлено | ||
| BR24992940 | "Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262" | "Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262" | "Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262" | 32928 | 1 | 32928 | 50/50% | Поставлено | ||
| BR24992940 | 0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799 | 0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799 | 0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799 | 64878 | 1 | 64878 | 50/50% | Поставлено | ||
| BR24992940 | Deionized water, 500 ml, Hach, HACH27249 | Deionized water, 500 ml, Hach, HACH27249 | Deionized water, 500 ml, Hach, HACH27249 | 26320 | 1 | 26320 | 50/50% | Поставлено | ||
| BR24992940 | 2-mercaptoethanol 99%, pure, 250 ml, Thermo Scientific, ACRO125472500 | 2-mercaptoethanol 98-99%, pure, 250 ml, Thermo Scientific, ACRO125472500 | 2-mercaptoethanol 99%, pure, 250 ml, Thermo Scientific, ACRO125472500 | 44480 | 1 | 44480 | 50/50% | Поставлено | ||
| BR24992940 | "Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290" | "Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290" | "Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290" | 47040 | 1 | 47040 | 50/50% | Поставлено | ||
| BR24992940 | Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500 | Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500 | Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500 | 36288 | 1 | 36288 | 50/50% | Поставлено | ||
| BR24992940 | Laptop | Laptop Apple MacBook Pro 16 MK183 512Gb Space Gray 16.2" 3456 x 2234, IPS, 120 Hz, Apple M1 Pro (10 cores), 16 Gb, SSD 512 Gb, integrated video card, Mac OS, cover color gray, battery 100 Wh | 4 Laptop Laptop Apple MacBook Pro 16 MK183 512Gb Space Gray 16.2" 3456 x 2234, IPS, 120 Hz, Apple M1 Pro (10 cores), 16 Gb, SSD 512 Gb, integrated video card, Mac OS, cover color gray, battery 100 Wh To fill in the research data in the IFA and IAS. Storing data in digital form helps to create a database for each animal, which simplifies the accounting and analysis of breeding work 852 501 March-April 50/50 Burambaeva N 87058312315 | 803935 | 1 | 803935 | Наурыз-сәуір | 50/50% | В период поставки | |
| BR24992940 | Sheep handling crate | Sheep handling crate with built-in scales and animal recognition sensors by RFID chip | To carry out animal grading, determining live weight at different periods of growth and development of sheep | 2700000 | 1 | 2700000 | 50/50% | Поставлено | ||
| BR24992940 | Portable animal sperm analyzer with iPad | iSperm mCASA – a mobile computer-assisted sperm analysis system (mCASA) | For fast and accurate assessment of ram semen quality | 3000000 | 1 | 3000000 | Наурыз-сәуір | 50/50% | Поставлено | |
| BR24992940 | Animal feed – Hay | Color - from green to yellow-green or green-brown. Appearance - no signs of moldiness, no moldy layers. Smell - no signs of musty, moldy, putrid or other foreign odors. Content of harmful and poisonous plants no more than 1%. The presence of foreign impurities, including clods of earth, stones, fuels and lubricants - is not allowed. Consistency - non-smearing, without sliminess. Content of crude protein, g / kg dry matter (DM), not less than: 120-90. Content of crude fiber, g / kg dry matter, not more than: 290-320. Content of acid-detergent fiber, g / kg dry matter, not more than: 380-430. Neutral detergent fiber content, g/kg dry matter, no more than: 650-720. Crude ash content, g/kg dry matter, no more than 100-90. Dry matter content, g/kg, no less than 830. Metabolic energy content*, MJ/kg DM, no less than: 8.9-7.9. Delivery of goods in bales, no less than 20 kg in one bale. Quantity of goods purchased = 5 tons | for animal feeding | 30000 | 10 | 300000 | may | 100% | В период поставки | |
| BR24992940 | Animal feed – Oats | Color – white, yellow, large cylindrical or pear-shaped grain. Content of grains of another type or subtype no more than 10%. in a healthy, unheated state. Smell without mold, malt, musty and other foreign odors. Humidity no more than 13.5%. Natural weight no less than 550-520 g/dm. Kernel no less than 65-63%. Weed impurity no more than: including: mineral impurity 0.2%; pebbles 0.1%; wild oats 2.0%; cockle 0.2%. Grain impurity no more than: including: oat grains classified as grain impurity 3.0%; sprouted 2.0%; grains and seeds of other cultivated plants (barley, rye) 1.0%. Small grains no more than 3.0%. Acidity (degrees) no more than 6.0-8.0. The content of toxic elements (benzapyrene, pesticides, radionuclides, harmful impurities, genetically modified organisms, pest infestation and contamination with dead insect pests in oat grain should not exceed the permissible levels established by regulatory legal acts in force in the territory of the Republic). The quantity of goods purchased = 3 tons" | for animal feeding" | 200000 | 2 | 400000 | may | 100% | В период поставки | |
| BR24992940 | Laptop Apple MacBook Air A3114 | Processor Apple M1 Pro (10-core) Graphics Apple M1 Pro (16-core GPU) RAM 16 GB Unified Memory SSD 512 GB Display 16.2", Liquid Retina XDR, 3456×2234, 120 Hz, up to 1600 nits Ports 3× Thunderbolt 4, HDMI, SDXC, MagSafe 3, 3.5 mm Battery 100 Wh, up to 21 hours of video playback, fast charging Camera/Audio 1080p FaceTime, 6-speaker system Dimensions/Weight ~35.6×24.8×1.68 cm / ~2.15 kg Color Space Gray | The device, with high performance and energy efficiency, ensures stable operation with resource-intensive professional software, which is essential for the effective completion of project and research tasks. | 901968 | 2 | 1803936 | - | 50/50% | В период поставки |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23488960 | Rotary evaporator RE100-Pro. | Specifications: -Large, easy-to-read digital LCD screen displaying heating temperature, rotation speed, and synchronization. -Speed range: 20 to 280 rpm. -Large 5L water-oil heating bath with a temperature range from ambient temperature to 180°C. -Heating bath with precise temperature control and an adjustable safety circuit. -Removable control panel for remote operation. -Patented condenser (cooling surface of 1500 cm²) with excellent cooling efficiency. -Motorized lift with fast automatic release of the evaporating flask to the upper position in case of power failure. -Adjustable end position recognition for protecting the operator and sample from breakage. -Evaporating flask with an ejector, making it easy to remove. -Available with a timer function for precise process control. -Chemically resistant dual PTFE system and patented spring-loaded seal ensure excellent sealing. -PC connectivity via USB for monitoring and documentation of all parameters. Technical Specifications: -External dimensions (L × W × H): 457 × 465 × 583 mm -Net weight: 15 kg -Interface: RS 232 -Power supply: 110/220 V, 50/60 Hz -Gross weight: 40 kg -Packaging dimensions: 110 × 60 × 65 mm | For evaporation of liquid after extraction of plants and mud or one of its fractional components at reduced pressure. | 1 | 1 | 1 | 50/50% | Поставлено | ||
| АР23488960 | Freeze dryer Scientz-12N . | Country of Manufacture: China Technical Specifications: -Idle temperature: <-56°C -Freezing area: 0.12 m² -Plate capacity: 1.5 L -Water trapping capacity: 4 kg -Vacuum level: <10 Pa -Sample tray size: 4 × Φ200 mm -Power consumption: 1500 W -Power supply: 220 V / 50 Hz -Layer spacing: 70 mm -Cold trap size: Ø250 × 150 mm -Schering bottle capacity: Ø22:260 Ø16:480 Ø12: 920 | To remove moisture from substances using the sublimation method, which ensures the evaporation of water from ice without entering a liquid state. | 2 | 1 | 2 | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR24993178 | Reactor with mechanical stirring MSG1000-P3-T3-HC1-SV-R Country of origin: China This product includes a mechanical stirrer, a heating furnace, and an intelligent temperature controller. A 7-inch high-definition touchscreen is provided for temperature c | Country of origin: China This product includes a mechanical stirrer, a heating furnace, and an intelligent temperature controller. A 7-inch high-definition touchscreen is provided for temperature control and rotation speed adjustment. Equipped with a USB interface, changes in temperature, rotation speed, and other reaction process parameters are recorded in real-time and can be downloaded via a USB flash drive. Model: MSG1000-P3-T3-HC1-SV-R Nominal volume: 1000 ml Maximum operating temperature: 300 ℃ Design pressure: 10.3 MPa Heating mode: built-in stainless steel heating module Heating power: 1 kW Stirring speed: 400–1400 rpm (stepless speed adjustment) Stirring method: mechanical stirring | Development of technology for producing high-quality bitumen from by-products of oil production and refining, which allows improving the quality of bitumen | 8 | 1 | 8 | 50/50% | Поставлено | ||
| BR24993178 | Galvanic Bath GFD-23 | Bath volume: 10 liters Country of origin: China | For conducting comprehensive experimental studies on the extraction of non-ferrous, precious and rare earth metals from lead production slags | 7 | 1 | 7 | 50/50% | Поставлено | ||
| BR24993178 | Penetrometer SYD-2801E1 | I. General Description 1. The use of a high-precision temperature controller ensures convenient temperature adjustment and high accuracy of temperature control. 2. Equipped with a cold light source and magnifying glass, making it easy to operate and use. 3. Features a penetration display; the data is stable and accurate, and easy to observe. 4. Equipped with a coarse and fine adjustment function of the lifting frame, allowing easy alignment of the needle tip with the sample surface. II. Main Technical Specifications 1. Power supply: AC (220±10%) V, 50 Hz; 2. Measurement range: 0 to 600 penetrations; 3. Resolution: 0.1 penetration (0.01 mm); 4. Time settings: 5 s, 8 s, 10 s, 12 s, 30 s, 60 s, with an accuracy of less than ± 0.1 s; 5. Power consumption: 200 W; 6. Temperature control accuracy: 25 ℃ ± 0.1 ℃; 7. Constant temperature bath: chamber made of solid glass; 8. Stirring: magnetic stirrer, rotary stirring; 9. Operating environment: Temperature (15–35) ℃; Relative humidity ≤85%; 10. Dimensions: 260 mm × 400 mm × 640 mm (L × W × H); 11. Net weight: 16 kg. | to determine the penetration of petroleum bitumen by automatically measuring the depth of immersion in a test sample of a standard needle in weight, shape and size at a set temperature for a set time. | 1 | 1 | 1 | 50/50% | Поставлено | ||
| BR24993178 | Flotation Machine FML 12 (247 FL) | Useful chamber capacity, L – 12. Impeller diameter, mm – 100. Impeller rotation frequency, s⁻¹ – 15-30. Air volume sucked in by the impeller at maximum rotation frequency, L/s, not less than – 0,27. Foam scraper rotation frequency, rpm – 14. Drive power, kW - 0,25 | For the beneficiation of ore, other minerals, and industrial waste, as well as for the separation of relatively fine solid particles suspended in a liquid (or their extraction from the liquid) based on their ability to adhere to gas bubbles, oil droplets, etc., introduced into the suspension, in order to extract the valuable component. | 3 | 1 | 3 | may | 50/50% | Поставлено | |
| BR24993178 | Muffle furnace cabinet. | 655х875х835 | For ensuring the safe operation of muffle furnaces, it prevents harmful substances from entering the air. | 336 | 1 | 336 | may | 50/50% | Поставлено | |
| BR24993178 | Laboratory table with two exhaust drawers | 1250х650х800 | for conducting experiments and organizing a workspace. | 636 | 1 | 636 | may | 50/50% | Поставлено | |
| BR24993178 | Laboratory fume hood with standard glass | 1200х800х2200 | to conduct experiments safely and ensure proper ventilation in the laboratory. | 636 | 1 | 636 | may | 50/50% | Поставлено | |
| BR24993178 | Island laboratory table | 2 island tables, upper shelf, stainless steel sink table, drying rack | For conducting laboratory experiments. | 386 | 1 | 386 | may | 50/50% | Поставлено | |
| BR24993178 | Single-door closed cabinet | 500х400х1900 | For storage of laboratory equipment, reagents. | 116 | 1 | 116 | may | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23486449 | Laboratory services | Pathogenic including salmonella:kurt - 4800, protein precipitate of buttermilk – 4800; Listeria (L.monocytogenes): kurt - 12540, buttermilk protein precipitate – 12540; QMAFAnM: kurt - 2900, buttermilk protein precipitate – 2900; E. coli group bacteria (coliforms): kurt - 3000, protein residue of buttermilk – 3000; Yeast: kurt - 2700, buttermilk protein precipitate – 2700; Mold: kurt - 2800, protein precipitate of buttermilk – 2800; S.aureus: kurt - 3100, buttermilk protein precipitate – 3100; Determination of the viamine composition of the drug: A – 15000; E – 15000; D – 15000; C – 14500; B4 (choline) – 18800; Determination of the mineral composition of kurt: Calcium (Ca) – 9000; Magnesium (Mg) – 9000; Selenium (Se) – 9100; Protein: kurt – 12900, buttermilk protein precipitate – 12900; Fat: buttermilk – 10,500, protein residue of buttermilk – 10,500; Moisture: kurt – 3900, protein precipitate of buttermilk – 3900; Ash: kurt – 3900, buttermilk protein precipitate – 3900; Carbohydrates (counting method): kurt – 1000, protein residue of buttermilk – 1000; Mass fraction of table salt: kurt – 6300, protein precipitate of buttermilk – 6300. | For the implementation of Item 4 of the calendar plan for research and development. | 239780 | 1 | 239780 | 100% | Поставлено | ||
| АР23486449 | Automated measuring system Laktan 700 | Definable parameters (8 pcs.): fat, protein, dry matter, SOMO, density, lactose, added water, freezing point Measurement time: 1 minute and 30 seconds Types of milk: whole cow's milk (other types of milk are optional). to the order) Milk sample preparation: the ability to work with warm and cold milk Flushing: semi-automatic Connecting to a computer: via a USB port, Windows software is included. Connecting to a portable printer: Built-in printer Features: a special conveyor automates the process of preparation and delivery of analyzed samples | Pursuant to paragraph 8 of the calendar plan | 2500000 | 1 | 2500000 | 50/50% | Поставлено | ||
| АР23486449 | Food product testing services | Product: Kurt from secondary dairy raw materials with plant additives. Organoleptic tests – 1. Toxicological tests: pesticides – 1, mycotoxins – 1, heavy metal salts – 1, antibiotics – 1. Radiological tests – 1. | Product: Kurt from secondary dairy raw materials with plant additives. Organoleptic tests – 1. Toxicological tests: pesticides – 1, mycotoxins – 1, heavy metal salts – 1, antibiotics – 1. Radiological tests – 1. | 10390 | 1 | 10390 | 100% | Поставлено | ||
| АР23486449 | Buttermilk | Natural by-product of the dairy industry, rich in proteins and lactose. Quantity – 300 l. | Used in a scientific project | 105 | 1 | 105 | 50/50% | Поставлено | ||
| АР23486449 | Dried whey | Contains milk proteins, lactose, and minerals, used in the food industry. Quantity – 50 kg. | Studied for its effects on digestion and use as a functional ingredient. | 50 | 1 | 50 | 100% | Поставлено | ||
| АР23486449 | Soy concentrate | High-protein plant-based product, contains all essential amino acids. Quantity – 12 kg. | Used to study alternative protein sources in the food system. | 60 | 1 | 60 | 100% | Поставлено | ||
| АР23486449 | Sea salt | Natural source of minerals, contains magnesium, potassium, and trace elements. Quantity – 10 kg. | Used to study the effect of mineral composition on product quality. | 5 | 1 | 5 | 100% | Поставлено | ||
| АР23486449 | Milk | Natural source of proteins, fats, lactose, and calcium. Quantity – 800 l. | Used as the primary medium for studying dairy products. Total cost: 400,000 tenge | 400 | 1 | 400 | 100% | Поставлено | ||
| АР23486449 | Flax seeds | Rich in omega-3 fatty acids, fiber, and antioxidants. Quantity – 7 kg. | Used to study the functional properties of food components. | 21 | 1 | 21 | 100% | Поставлено | ||
| АР23486449 | AA-7000 spectrometer complete with Fe, Cd, Pd lamps | The spectral range is 185-900 nm. A three-dimensional two-beam optical circuit using a digital optical filter and elements that reduce radiation loss. | For research, for agriculture and food industry, for quality control, determination of heavy metals. | 30 | 1 | 30 | july | 50/50% | Поставлено | |
| АР23486449 | Laboratory services | Determination of fatty acid composition in 2 samples Determination of fat-soluble antioxidants in 1 sample Determination of water-soluble antioxidants in 1 sample | In pursuance of the calendar plan | 70000 | 1 | 70000 | may | 100% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23485656 | Conceptualization, development of objects of an intelligent expert system for prediagnosis in medicine using neural networks | Conceptualization and development of objects of an intelligent expert system for prediagnosis in medicine using neural networks will be carried out. | Conceptualization, development of objects of an intelligent expert system for prediagnosis in medicine using neural networks | 4000000 | 1 | 4000000 | 100% | Поставлено | ||
| АР23485656 | The MLS400 Residual Current Device | The MLS400 device features a multi-layer protection system that provides automatic disconnection in case of electric shock risk, short circuit, or ground leakage. It includes automatic insulation, grounding control, and self-monitoring capabilities. The unit is highly sensitive, reliable, and has a fast response time of no more than 0.2 milliseconds. The operating input voltage range is 150–264 V, and the output voltage is 220±4 V. | The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts. | 1 | 1 | 1 | may | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| BR21882447 | HANNA HI 99161 pH meter (portable). | HANNA HI 99161 pH meter (portable). pH range -2 : 16 pH temperature -5 : 105°C Resolution pH 0.01 pH temperature 0.1°C pH error ±0.02 pH temperature ± 0.5 °C to 60 °C; ± 1.0 °C outside ± 1.0 °F to 140 °F; ± 2.0 °F outside pH calibration is automatic, at one or two points with two sets of standard buffers (pH 4,01 / 7,01 / 10,01 or pH 4,01 / 6,86 / 9,18 ), established by Standard: 4.01; 7.01; 10.01 or NIST: 4.01; 6.86; 9.21 Thermal compensation Automatically from -5.0 to 105.0 °C pH FC2023 electrode Battery 3 x 1.5V AAA Battery life 1400 Operating conditions temperature 0 : 50°C humidity up to 100% Dimensions 154 x 63 x 30mm Weight 199g | For measuring pH and temperature in dairy and meat products. pH monitoring is crucial to ensure the quality of products. | 990470 | 1 | 990470 | 50/50% | Поставлено | ||
| BR21882447 | Bowls for planetary ball mill | The volume is 500ml. For use in SQL 4 Ball Mill. | For planetary ball mill | 559550 | 1 | 559550 | 50/50% | Поставлено | ||
| BR21882447 | Desiccator | The diameter of the container is 15-30 cm. | For slow drying at room temperature, storage of hygroscopic compounds, in gravimetric analysis, when it is important to prevent saturation of the studied substances with an indefinite amount of water from the air. | 35000 | 1 | 35000 | 50/50% | Поставлено | ||
| BR21882447 | Texture analyzer "Structurometer ST-2" (RF) | Texture analyzer "Structurometer ST-2" | The texture analyzer “Structurometer ST-2” is designed to determine the rheological characteristics of raw materials, semi-finished products and finished products | 14640000 | 1 | 14640000 | 50/50% | Поставлено | ||
| BR21882447 | SFA 06E Fat Analyzer | SFA 06E Fat Analyzer Technical characteristics of the SFA-06E fat analyzer • Sample weight, g — 0.5-20.0; • measuring range, % — 0.1-100.0; • solvent volume, ml — 500.0; • solvent extraction, % — not less than 85; • number of samples per batch — 6; • heating temperature, °C — room temperature +5 – 100; • dimensions, W×D×H, mm — 740×260×660; • weight, kg — 50. | The fat analyzer is widely used in the food and feed industries. It measures the fat content using the Soxlet extraction method, using extraction by heating and soaking, solvent regeneration and cooling | 4740000 | 1 | 4740000 | 50/50% | Поставлено | ||
| BR21882447 | Registration of a patent for a utility model (2 pcs.) | Identification of signs of inventions or utility models in research materials on the topic. Conducting a patent search through the collections of patent and scientific and technical documentation to identify analogues and prototypes. Registration of application documents for obtaining a patent of the Republic of Kazakhstan for an invention or utility model | Scientific and technical task №. 103 on program-targeted financing of administrators of budget programs for 2024-2026 | 100000 | 1 | 100000 | 100% | Поставлено | ||
| BR21882447 | Radiation treatment service at ELV-4 and ILU-10 accelerators | The total amount of radiation treatment services is 2 hours. The radiation dose is 3 kg, 6 kg, 9 kg. The name of the studied samples: beef meat, barley, wheat, bran, mixed feed. | For the implementation of paragraph 4.1 of the calendar plan for research and development. | 111800 | 1 | 111800 | 100% | Поставлено | ||
| BR21882447 | raw material | Turkey meat 25 kg - 2500 tg; Beef meat 30 kg - 3500 tg; Lamb meat 25 kg - 3000 tg; Horse meat 25 kg - 3500 tg; Dried fruits 10 kg - 5000 tg; Dry herbs 5 kg - 4000 tg; Fish 15 kg - 4,500 tg Seafood 15 kg - 5500 tg; Spices 5 kg - 5000 tg; Seasonings 5 kg - 5000 tg; Compound feed 10 kg - 500 tg. | For laboratory work | 605000 | 1 | 605000 | 100% | Поставлено | ||
| BR21882447 | Laboratory services | Determination of the mass fraction of protein, amino acid content (arginine, lysine, tyrosine, phenylalanine, histidine, leucine+isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine), determination of fat acidity, determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc), quantitative determination of iron, zinc, pestecides, determination of QMAFAnM, determination of mold) | For the implementation of paragraph 4.1 of the calendar plan for research and development. | 692000 | 1 | 692000 | 100% | Поставлено | ||
| BR21882447 | Laboratory services | Determination of mycotoxins | For the implementation of paragraph 4.1 of the calendar plan for research and development. | 82000 | 1 | 82000 | 100% | Поставлено | ||
| BR21882447 | IT infrastructure maintenance and technical support services | Разработка и применение цифровой технологии в комплексной системе «поле – обработка – хранение – переработка – готовая продукция» по повышению количественно-качественной сохранности и безопасности сельскохозяйственного сырья и продуктов его переработки | Бағдарламаның күнтізбелік жоспарының тармақтарын орындау мақсатында | 4000000 | 1 | 4000000 | 50/50% | Поставлено | ||
| BR21882447 | Radiation treatment service at ELV-4 and ILU-10 accelerators. | The total amount of radiation treatment services is 2 hours. The radiation dose is 3 kg, 6 kg, 9 kg. The name of the studied samples: beef meat, barley, wheat, bran, mixed feed. | For the implementation of paragraph 4.1 of the calendar plan for research and development. | 300000 | 1 | 300000 | april | 100% | Поставлено | |
| BR21882447 | Monograph publication | Monograph Title: Development of a Food Safety System for Long-Term Storage Based on Electrophysical and Radiation Processing Methods Authors: D.R. Orynbekov, K.Zh. Amirkhanov, B.K. Asenova, Zh. Kalibekkyzy, A.N. Nurgazezova, G.N. Nurymkhan, N.R. Muslimova At present, ensuring the safety of food products and extending their shelf life are issues of global significance. The increase in microbiological contamination of food, challenges in transportation and storage conditions, as well as growing consumer demand for high-quality and safe products, all require the introduction of new technologies. In this context, electrophysical and radiation processing methods are considered scientifically and technologically grounded, effective approaches for preserving the freshness of food products—particularly meat and meat products—for extended periods. This monograph presents the theoretical foundations of electrophysical and radiation processing, the mechanisms of physicochemical impact, their effect on microbiological safety, and the results of specific experimental studies. In particular, scientifically based recommendations are provided for enhancing product safety and extending shelf life through treatment using low-energy electron irradiation. | In fulfillment of the points of the program's calendar plan." | 520 | 1 | 520 | Мау | 50/50% | Поставлено |
For better viewing of the table, rotate your device or scroll horizontally.
| IIN | Name | Description | Equipment Purchase Justification | Planned Cost | Quantity | Amount | Purchase Deadlines | Payment Terms | Status | Submit Commercial Proposal |
|---|---|---|---|---|---|---|---|---|---|---|
| АР23484846 | laptop | Operating system - Windows 10 Home; Operating system architecture - 64-bit; Updatable Windows OS - yes; Processor manufacturer - Intel Core i5; Processor frequency - 3 GHz; Processor core - Six-core (6 cores); Total installed system memory of at least 8 GB; Total capacity of solid-state drives of at least 512 GB; Screen resolution 1920 x 1080; Standard refresh rate - 144 Hz; Maximum battery life - 10 hours, preferably gray | To perform work remotely | 485749 | 1 | 485749 | 50/50% | Поставлено | ||
| АР23484846 | Dumpling machine | Dumpling machine. Technical characteristics of the dumpling machine Capacity, pcs / h 3600 Weight of the dumpling- depends on the setting Power consumption 2.5 kw Overall dimensions, mm 640 x 440 x 810 Weight, not more than kg 100 | Designed for automatic molding of dumplings from available ingredients | 1430500 | 1 | 1430500 | 50/50% | Поставлено | ||
| АР23484846 | The cutlet shaper is automatic. | Power: 0.55 kW Container capacity: 32 L Voltage: 380V, 50 Hz Size: 850*600*1400 mm Weight: not more than 100 kg Capacity: no more than 2100 pcs/hour | Table-top automatic cutlet shaper for forming cutlets up to 100 mm in diameter | 2927900 | 1 | 2927900 | 50/50% | Поставлено | ||
| АР23484846 | Spiral dough mixer 60l. | Power: 2.2 kW Mixing speed: 125/250 rpm Voltage: 220V/380V/50Hz Size: 880*530*920 mm Weight: up to 180 kg Capacity: approximately 22-25 kg Bowl capacity: 60 L | To minimize the cooking time of the dough kneading. | 2088656 | 1 | 2088656 | 50/50% | Поставлено | ||
| АР23484846 | Horse meat | Horse meat of the highest grade in accordance with GOST 27095. Quantity – 80 kg. | Conducting laboratory work in accordance with the calendar plan | 3700 | 80 | 296000 | 100% | Поставлено | ||
| АР23484846 | Turkey meat | Dietary product, low-fat content, high in protein and selenium. Quantity – 20 kg. | Included in the research to analyze its effects on protein metabolism and digestion. | 2400 | 20 | 48000 | 100% | Поставлено | ||
| АР23484846 | Chicken meat | Easily digestible protein source, rich in vitamins B6 and B12, suitable for various dietary studies. Quantity – 20 kg. | Used to study its impact on protein absorption and energy metabolism in the body. | 2000 | 20 | 40000 | 100% | Поставлено | ||
| АР23484846 | Beef | Rich in iron, protein, and amino acids, supports muscle mass formation. Quantity – 80 kg. | Used to analyze nutritional value and amino acid metabolism effects. | 4000 | 80 | 320000 | 100% | Поставлено | ||
| АР23484846 | Lamb | High nutritional value, contains omega-3 fatty acids and antioxidants. Quantity – 80 kg. | Studied within the project to evaluate its effects on lipid metabolism and digestion. | 3700 | 80 | 296000 | 100% | Поставлено | ||
| АР23484846 | Sheep tail fat | Natural fat source, rich in unsaturated fatty acids. Quantity – 40 kg. | Studied to assess its effects on fat metabolism and absorption. | 4000 | 40 | 160000 | 100% | Поставлено | ||
| АР23484846 | Green buckwheat | Rich in antioxidants, fiber, and plant-based protein. Quantity – 40 kg. | Used to study its effects on blood sugar levels and digestive processes. | 48 | 1 | 48 | 100% | Поставлено | ||
| АР23484846 | Wheat flour | Source of carbohydrates, contains B vitamins and fiber. Quantity – 40 kg. | Studied for its impact on glycemic levels and metabolic processes. | 14 | 1 | 14 | 100% | Поставлено | ||
| АР23484846 | Food product analysis | Characteristics and justification for purchasing services to analyze 7 food samples (meat and meat products) within the scientific project: Water Activity (Aw) Required to evaluate the microbiological stability and shelf-life of meat products. Water activity determines the potential risk of microbial growth and spoilage, affecting product safety and quality. Acidity (pH) A critical parameter determining the quality of meat and meat products, including texture, color, microbiological safety, and the rate of product maturation. Moisture Holding Capacity (MHC) Important for assessing the quality of raw materials and finished products, as it directly affects the texture, juiciness, and technological characteristics of meat products, influencing consumer appeal and production technology parameters. Water Binding Capacity (WBC) A key indicator affecting moisture retention during technological processing, directly influencing the yield and economic efficiency of finished products. Fat Holding Capacity (FHC) Affects the ability of raw meat materials and finished products to retain fats, which is critical for organoleptic properties, stability, and overall product quality. | Conducting these analyses is necessary for the implementation of a scientific project studying the functional-technological properties of meat raw materials and products derived from them. The obtained results will enable the development of scientifically-based recommendations for optimizing recipes and production technologies of meat products, enhancing their safety, quality, and competitiveness in the market. | 94500 | 1 | 94500 | 100% | Поставлено | ||
| АР23484846 | Food Research | Within the framework of the scientific project, 8 samples of meat and meat semi-finished products will be investigated for: Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine+isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) 1 by Capillary Electrophoresis, Determination of fatty acid composition by Gas Chromatography (GC), Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by Capillary Electrophoresis, Determination of the amount of Vitamin C, Determination of iron, Determination of magnesium, Determination of calcium, Determination of iodine, Determination of lead, Determination of arsenic, Determination of potassium-40, Determination of cesium-137, Determination of TAMC (Total Aerobic and Facultative Anaerobic Microorganisms), Determination of BGKP (coliforms), Determination of pathogenic bacteria, including Salmonella, Determination of L. monocytogenes, Determination of sulfite-reducing clostridia. | The laboratory tests in question are a necessary stage of the scientific work, providing objective data on the quality and safety of radiation-processed meat semi-finished products. The results will be used for scientific reporting and the preparation of publications. | 527600 | 1 | 527600 | april | 50/50% | Поставлено |