Shakarim University - Главная

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26196803	Raw material	Horse meat 300kg3700=1110000 Sunflower oil 50L1000=50000 Rapeseed oil 50L1250=62500Linseed oil 25L5000=125000 Margarine 5kg*1500=7500	Equipment is necessary to implement	1355000	1	1355000	-	100%	During the delivery period
AP26196803	Reagents	Hydrogen peroxide concentrated 3L1000=3000 Sulfuric acid concentrated 3kg2000=6000 Hydrochloric acid concentrated 3kg1600=4800 Diethyl ether 3L9500=28500 Reagents for Karl Fischer titration 4pcs*122000=48800	Equipment is necessary to implement	530300	1	530300	-	100%	During the delivery period
AP26196803	Karl Fischer Automatic Titrator	TitroLine® 7500 KF: volumetric titration, titration to the end point (SO2, bromine number). Delivery set: titrator, replaceable module WA 10, TM 235 KF stand with integrated stirrer and pump, titration vessel TZ 1770, double platinum micro-electrode KF 1100 and start-up kit, power supply 100-240 V. Dosing volume: 10 ml. Dosing accuracy: 0.15 R%. Dimensions (WxDxH) 153 x 296 x 450 mm. Power supply 100 … 240 V, 50/60 Hz. Manufacturer: SI Analytics, Germany.	Equipment is necessary to implement	7085607	1	7085607		70/30%	During the delivery period
AP26196803	Water distiller	Electric Water Distiller AE-5. Production of distilled water for laboratory and technological needs. Electric. Capacity: 5 L/h, body and vessels: stainless steel, 220 V, 50/60 Hz. Power: 1.5 kW. Dimensions (WxDxH): 300 x 250 x 450 mm. Weight: 12 kg. Manufacturer: Russia.	Equipment is necessary to implement	526361	1	526361		50/50%	During the delivery period
AP26196803	Soxhlet Extraction Apparatus (portable)	Soxhlet Extraction Apparatus, 300 ml, NS 60/466 Duran. Extraction of fats and other soluble components from solid samples in laboratory conditions. Flask volume: 300 ml. Flask material: Duran glass. Connections: NS 60/466. Durable laboratory apparatus, compatible with various solvents, reusable. Weight: 1.2 kg. Manufacturer: Duran. Country of origin: Germany.	Equipment is necessary to implement	188264	1	188264	-	50/50%	During the delivery period
AP26196803	Scientific research service	Аnalysis of physico-chemical properties of vegetable oils and horsemeat fat	Research within the project	600000	1	600000		50/50%	During the delivery period

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26198515	Raw material	1 beef 100 kg * 4000=400,000 2 horse meat 80 kg * 3800=304000 3 by-products 100 kg * 2500=250,000 4 intestines (beef, horse, mutton) 100 m * 2400 =240000 5 additional meat raw materials 50 kg * 3000 = 150,000 6 chicken soups 50 kg * 500 = 25000 7 Blood 50 L * 450 =22,500 8 liver 50 kg * 2500= 125000 9 vegetables 50 kg * 400=20,000 10 sunflower oil 50L * 900=45000 11 melange 10 kg * 320 = 3,200	Conducting laboratory work in accordance with the calendar plan	1627700	1	1627700	november	100%	During the delivery period
AP26198515	Packaging containers	Used to protect products from damage, contamination, and external factors	Necessary for preserving product quality and protecting against external factors (moisture, contamination, microbial impact).	100	200	20000	november	100%	During the delivery period
AP26198515	Мeat roll molds	They define the shape and volume of the product (loaves, rolls), used for cold/warm forming and resting before heat treatment; facilitate the filling of the mince into casings or trays and ensure a uniform appearance of the product	Тo ensure the correct shape and density of the product	2300	10	23000	november	100%	During the delivery period
AP26198515	Universal thermal chamber	Comprehensive processing of semi-finished products - cooking (steam/heating), smoking (hot/cold), drying, and curing; provides sterile heat treatment, even heating, humidity control, and/or smoke supply control. Used for boiled, smoked, and semi-smoked sausages. For small workshops, simpler equipment (used or small models) can be selected. When choosing, pay attention to the power of the steam generator, material stainless steel, temperature and humidity control, and smoke generation system	Universal thermal chamber for conducting controlled temperature testing and product processing	7912000	1	7912000	october - november	50/50%	During the delivery period
AP26198515	Тabletop vacuum sealer	Air removal from packaging and airtight sealing – extends shelf life, prevents oxidation and growth of aerobic microorganisms; used for already chilled products, raw materials, and finished loaves before sale. In industry – either chamber vacuum sealers (for whole loaves) or external “bag” models for small batches. Budget brands/options: the market offers industrial and tabletop/portable vacuum sealers; available brands include Hurakan, VIATTO	Vacuum packaging machine for removing air from packaging	550000	1	550000	november	50/50%	During the delivery period
AP26198515	Сutter HURAKAN HKN-CL35MSW	Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops	The cutter is used to obtain homogeneous and pliable meat mince, improve product texture, and enhance the quality of the finished meat products.	1733140	1	1733140	november	50/50%	During the delivery period
AP26198515	Сlipper	Grinding and emulsifying the meat mass, evenly distributing fat and additives, creating a homogeneous meat emulsion; accelerates the formation of the protein network (important for boiled and semi-smoked sausages), allowing for a smooth texture. According to HURAKAN HKN-CL35MSW: industrial cutter with a 38 L capacity, power ≈5 kW, speed 1400 rpm — suitable for small and medium workshops	The clipper is used for reliable sealing of packaging, ensuring airtightness and preserving product freshness	180000	1	180000	november	50/50%	During the delivery period

Барлығы: 7 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР26197931	Wind pumping unit	Rotor diameter: up to 2.4 m Blade material / quantity: galvanized steel / 18 pcs Start wind speed: not less than 2.5 m/s Operating wind speed: 6–8 m/s Maximum operating wind speed: up to 40 m/s Nominal stroke rate: up to 32 strokes/min Braking system: manual brake Tower height: up to 12 m Total weight (with tower): up to 400 kg Service life: up to 20 years	Equipment is necessary to implement the project.	2700000	1	2700000	october	70/30%	During the delivery period
АР26197931	Installation works of the purchased wind-pumping unit.	Installation and commissioning works of the purchased wind-pumping unit above the well.	The service is required for the further implementation of the project.	1100000	1	1100000	october	70/30%	During the delivery period
АР26197931	Well drilling	Well drilling with a metal casing pipe of 133 mm diameter. The maximum well depth is 24 meters.	The service is required for the further implementation of the project.	1150000	1	1150000	october	70/30%	During the delivery period
АР26197931	Rental of a flatbed cargo truck.	Rental of a flatbed cargo truck	The service is required for the further implementation of the project.	670050	1	670050		70/30%	During the delivery period
АР26197931	Rental of a truck crane.	Rental of a truck crane for lifting and installation works.	The service is required for the further implementation of the project.	25000	4	100000	-	70/30%	During the delivery period
АР26197931	Steel Pipe	Ø133/4, length 24 m (12х2=24)	Equipment is necessary to implement the project	6177	2	12354	october	70/30%	During the delivery period
АР26197931	Rental of a truck-mounted crane (manipulator).	Rental of a truck-mounted crane (manipulator) on a flatbed vehicle for installation and loading/unloading operations.	The service is required for the further implementation of the project.	20000	8	160000	october - november	70/30%	During the delivery period
АР26197931	Bench lathe with pedestal	JET BD-11G Desktop Lathe Turning diameter over cross slide: up to 170 mm Spindle speed: not less than 150 rpm — up to 2000 rpm Number of spindle speeds: 6 Spindle taper: MT-4 Spindle bore diameter: up to 26 mm Longitudinal feed range: 0.07 – 0.4 mm/rev Number of longitudinal feeds: 6 Metric thread range: 0.2 – 3.5 mm Number of metric threads: 21 Inch thread: 8 – 56 TPI Number of inch threads: 21 Leadscrew pitch: Tr 20x3 Max tool size: up to 12 × 12 mm Cross slide travel: up to 145 mm Top slide travel: up to 60 mm Tailstock taper: MT-2 Tailstock quill travel: up to 80 mm Quill diameter: up to 30 mm Fixed steady rest range: up to 25 mm Moving steady rest range: up to 25 mm	Equipment is necessary to implement the project.	2300000	1	2300000	-	70/30%	During the delivery period
АР26197931	Desktop Drilling Machine with workbench	Power: not less than 750 W Supply voltage: up to 400 V Motor type: asynchronous Spindle speed: not less than 200 rpm — up to 2350 rpm Tool shank diameter: up to 16 mm Belt type: Poly-V 5PJ450 Transmission type: belt Worktable material: cast iron Worktable size (L×W): up to 275 × 245 mm Base size: up to 345 × 520 mm Table tilt angle: up to -45°…+45° Number of spindle speeds: 5 Spindle taper: KM2 Chuck type: keyed Spindle quill travel: up to 96 mm Max distance spindle–table: up to 410 mm Max distance spindle–base: up to 650 mm Base material: cast iron Spindle–column distance: up to 205 mm Laser pointer: yes Lighting: yes Chuck mount: B16 Column diameter: up to 70 mm Fork type: TH-015T Max table load: up to 30 kg Threading function: yes Max drilling diameter in wood: up to 50 mm Power cord length: up to 1.8 m Max drilling diameter in soft metals: up to 20 mm Max drilling diameter in hard metals: up to 18 mm Dimensions (L×W×H): up to 710 × 585 × 1120 mm Packing dimensions (L×W×H): up to 1060 × 610 × 380 mm Net weight: up to 96 kg Gross weight: up to 96 kg Delivery set: 1 pc. Warranty period: 12 months Extended warranty: +24 months Country of origin: China	Equipment is necessary to implement the project.	1449351	1	1449351	-	70/30%	During the delivery period
АР26197931	VP-E Metal Workbench with	Dimensions (L × W × H): up to 860 × 1000 × 685 mm Maximum load capacity: up to 500 kg Worktop: MDF desktop covered with galvanized sheet metal Included: hanging drawer, two supports Color: blue RAL 5002 and yellow RAL 1003 (can be painted in any RAL color) Construction: metal workbench, double-cabinet (two pedestals) Model code: VP-E	Equipment is necessary to implement the project.	125000	2	250000		70/30%	During the delivery period

Барлығы: 10 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26101621	Ultrasound system with Doppler imaging	Ultrasound device with doppler, Draminski Blue (complete set with three sensors and additional software for the study of cattle, MRS, Pigs, Horses, small pets), Poland	Equipment is necessary to implement the project.	30000000	1	30000000		70/30%	During the delivery period
AP26101621	Veterinary first-aid kit	45 L thermal case with surgical kit (vet option: with veterinary surgical kit)	Equipment is necessary to implement the project.	75000	4	300000	-	50/50%	During the delivery period
AP26101621	ELISA kit for bovine LPS (lipopolysaccharide)	Bovine LPS (lipopolysaccharide) ELISA kit, 96 tests, ELK8425	Reactive is necessary to implement the project.	302741	10	3027410	-	50/50%	During the delivery period

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26100579	Monoblock	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Equipment is necessary to implement the project.	400000	10	4000000	october	50/50	During the delivery period
AP26100579	Refrigeration equipment	DEXP freezer cabinet F4-28AMA - 275 490 tg Refrigerator LG GC-B509MLWM - 351 490 tg	Equipment is necessary to implement the project.	626980	1	626980	-	50/50	During the delivery period
AP26100579	SimpliAmp Amplifier	Thermal cycler for DNA amplification. Used in PCR studies.	Equipment is necessary to implement the project.	3990517	1	3990517	october	50/50	During the delivery period
AP26100579	consumables for PCR research	Primer rDNA16S V1-V5 region, Bact-8F, AGAGTTTGATCCTGGCTCAG 2х14560=29120 Primer rDNA16S V1-V5 region, Bact-936R, 4 GTGCGGGCCCCCGTCAATTC 2х14560=29120 D-Cells kit for DNA extraction from animal and bacterial cells, 250 isolations 1х479941,28=479941,28 Agarose for electrophoresis (Low-BEO), 100 g 2х69328=138656 Immunological tablet, 96-well 20х1128,96=22579,20 MiniMed vacuum tube with K2-EDTA, 2ml, 100 pcs 10х11901,12=119011,20 Laboratory test tube 15 ml, conical 17*120 mm with screw eraser 3х50967,84=152903,52 Microcentrifuge tube 1.5 ml, graduated 500 pcs PCR Clean 3х7056=21168 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 1х7840=7840 Microcentrifuge tube 2.0 ml, graduated 500 pcs PCR Clean 3х10192=30576 bacteriological loop 1 µl with needle colorless (20 pcs/pack) 10х834,18=8341,76 bacteriological loop 10 µl with a colorless needle (20 pcs/pack) 15х834,18=12512,64 Tampon probe MiniMed sterile in a test tube pack of 100 pcs 5х13108,48=65542,40	To conduct research work	1117315	1	1117315	october	50/50	Delivered
AP26100579	materials for microbiological research	Diachym is a Gram coloring kit : 310900=32700 Petri dishes with PS lid (90×15mm) glass: 1001400=140000 1ml tip, 500pcs package: 29000=18000 Tips 200mkl (1000pcs=1up): 29000=18000 Tip for dispenser 10ml IKA: 2*12000=24000	To conduct research work	232700	1	232700	october	50/50	Delivered
AP26100579	Nutrient media	Triptic Soy Agar, 2х44500=89000 Triptic Soy Broth, 2х44500=89000 CHROMagar Enterobacter, 2х144000=288000 CHROMagar Staphylococcus, 2х161000=322000	To conduct research work	788000	1	788000	october	50/50	Delivered
AP26100579	Samsung Odyssey G4 LS25BG400EIXCI 25 Full HD/IPS/1ms/240Hz Monitor	Screen size: 25″ (63.5 cm) Resolution: 1920×1080 (Full HD) Panel type: IPS Refresh rate: up to 240 Hz Response time: 1 ms (GtG) Brightness: 400 nits Features: AMD FreeSync Premium, NVIDIA G-Sync compatible Ports: DisplayPort 1.2, HDMI 2.0 Adjustments: height, tilt, swivel, VESA mount 100×100	Equipment is necessary to implement the project.	104990	1	104990	october	50/50	Delivered
AP26100579	Indesit DS 4200W Refrigerator	Refrigerator for storing biological reagents and samples.	Equipment is necessary to implement the project.	189990	1	189990	october	50/50	Delivered
AP26100579	CHROM agar Orientation	A chromogenic medium designed for isolation and presumptive identification of microorganisms from clinical samples. Different bacteria produce colonies in distinct colors, enabling rapid and accurate differentiation.	To conduct research work	281505	1	281505	-	50/50	During the delivery period
AP26100579	Master Mix Red Taq DNA Polymerase 2X, 1,5 мМ MgCl₂, 500 тестов, Avantor	A ready-to-use mixture for DNA amplification. Contains 1.5 mM MgCl₂ and Taq polymerase. Suitable for 500 tests. Provides convenience and consistent, reliable results.	To conduct research work	171160	1	171160	-	50/50	During the delivery period
AP26100579	Veterinary medical consumables	Forceps for dressing 10x2900=29000 Surgical scissors 10x2500=25000 First aid kit 1x14452=14452 Sterile gloves 2x2500=5000 Sterile disposable scalpel 100x1500=150000 Safety glasses closed 10x1250=12500 Filter paper 100×100cm 3x5200=15600 Disposable three-layer mask 100x45=4500 Alcohol, 96% 5x3000=15000 Polyester bags for honey. Waste, class A 4x1500=6000	To conduct research work	277052	1	277052	-	50/50	During the delivery period
AP26100579	consumables for PCR research	Adhesive coating for 96-well plates 100 pcs/pack - 78 881 tg PCR tablets, 96 wells, without stability skirt, colorless, 25 pcs/pack - 75 669 tenge TAE Buffer (Tris-Acetate EDTA) (50X), 1 l. - 65 351 tenge Water without nucleases, 30 ml. - 25 311 tg PCR master mix (2X), 200 reak. - 74 591 tg DNA loading dye in gel (6X), 5 x 1.0 ml. - 38 269 tg DNA Marker GeneRuler 1 kb, 5x50 micrograms. - 93 198 тг	To conduct research work	451270	1	451270	-	50/50	During the delivery period

Барлығы: 12 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19680272	LED screen	Led screen 1860x3300 cm with a resolution of P 2.5 With an acoustic system	Purchase of LED screen for use in conducting a special course developed on the basis of a scientific project and presentation of the project results.	3285388	1	3285388	-	50/50%	During the delivery period
AP19680272	Publishing books	Publication of a Book Series 1. Publication of an Anthological Collection: volume — 800–950 pages, bound. Print run — 300 copies. Hard cover, white paper. 2. Publication of a Linguistic Dictionary: volume — 180–300 pages, bound. Print run — 100 copies. Hard cover, white paper. 3. Publication of a Monograph: volume — 140–200 pages, bound. Print run — 100 copies. Hard cover, white paper.	Summarizing the results of the project research and publishing scientific products according to the schedule.	1600000	1	1600000	-	50/50%	During the delivery period

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР19680032	Purchasing an interactive panel	nteractive panel MARTITOUCH 75 dm Negyzgi sipattamalary: Android 14 // core processor Jads: 8 Gb LPDDR 4x / 128 Gb Standards: 4K/Ultra HD (3840*2160) Number of tigizu sanas – 50 Zhauap take ukyty – 2.5 milliseconds Koru Buryshy – 178° Contrast sheets – 5000:1 Zhanartu zhiіligi – 60 Hz Zharkyndygy – 400 OPS kosymsha computer ornatuga arnalgan slot Interface: HDMI, USB 2.0, USB 3.0, USBTouch, RJ45, VGA, EARPHON Regarding our computer: Bluetooth 5.0, WiFi 2.4–5 GHz High quality 13 megapixel camera, built-in microphone, speaker. Key features: Screen-mounted, vandalized, toaded, Acoustic, powered – 48 W Zhiyntyk kuramynda: 2 marker, Kashyktan baskar remote control, kuat cables, Vesa bekitkishi (1 dan) Capildik merzimi: 12th OPS i5 8/256 Mobildi terek	Purchase of interactive panels for use in conducting a special course developed on the basis of a scientific project and presentation of the project results	1251445	2	2502890		50/50%	During the delivery period
АР19680032	Publishing a monograph	Topic: “Structural-semantic and linguacultural aspects of the vocabulary of social networks” Volume: 140 pages ISBN included.	Summarize the results of the project research and publish the monograph “Structural-semantic and linguacultural aspects of the vocabulary of social networks” in accordance with the calendar plan.	3250	500	1625000	-	50/50%	During the delivery period

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP26198315	Rotary evaporator model RI-213	Maximum heating temperature, °C 100 Standard flask capacity, ml 500 to 1000 Motor power, W 25 Heating element power, kW 1.5 Rotation speed, rpm 5…180 Lifting height, mm 130 Power supply, V/Hz 220/50 or 60 Steam power, kW 1.5 Steam dimensions (Ø×H), mm 240×150 Assembled dimensions (W×D×H), m 890×370×760 Assembled weight, kg 17	Equipment is necessary to implement the project.	1391000	1	1391000	october	50/50%	During the delivery period
AP26198315	Vacuum Filtration Device Series 400-SF10 (LF32)	Specifications Power supply: 220 V/50 Hz Maximum power consumption, W: 80 Maximum current consumption, A: 0.4 Maximum residual pressure, mmHg: 20 Maximum flow rate, l/min: 20 Motor speed, rpm: 1450 Nipple, inch (mm): 5/16 (8) Dimensions, LxWxH, cm: 33.5x23x45	Equipment is necessary to implement the project.	4400000	1	4400000	october	50/50%	During the delivery period
AP26198315	Monoblock	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Equipment is necessary to implement the project.	440253	8	3522024	october	50/50%	During the delivery period
AP26198315	Reagents	Gram Staining Kit, sodium hydroxide,phenolphthalein,isoamyl alcohol, magnesium stereinate	To conduct research work	242134	1	242134	october	50/50%	During the delivery period
AP26198315	Nutrient media	MRS agar,selective agar for streptacoccus, nutrient agar	To conduct research work	585790	1	585790	october	50/50%	During the delivery period
AP26198315	Apparatus for coagulating nutrient media ASIS-01	Specifications Operating temperature, °C: +40 to +90 Maximum number of simultaneously loaded tubes, 16-21 mm in diameter: 236 Tube tilt angle for horizontal cassette loading, º: 45 to 90 Power consumption, W: no more than 1000 Dimensions, mm: no more than 730×468×850 Weight, kg: no more than 65	Equipment is necessary to implement the project.	4650000	1	4650000	october	50/50%	During the delivery period

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP27508635	Steaks	steaks from angus	consumable material	25500	50	1275000	-	50/50%	During the delivery period
AP27508635	Steaks	steaks from Kazakh white-headed bulls	сonsumable material, расходный материал	9000	50	450000	-	50/50%	During the delivery period
AP27508635	Refrigerated display case	Refrigerated display, Length, mm:3750 Width, mm:1145 Height, mm:1485 Type:open Voltage:220 V Temperature range:-5...+5°C Cooling type:dynamic Refrigerant:R404A Current frequency:50 Hz	Equipment is necessary to implement the project.	660000	2	1320000	-	50/50%	During the delivery period
AP27508635	MiniScan EZ 4500L: Portable spectrophotometer	The MiniScan EZ 4500L is a portable spectrophotometer from HunterLab designed to accurately measure the reflected color of various samples. The 45°/0° geometry device (45° lighting, 0° surveillance) is ideal for quality control in production, providing reliable and reproducible results. The lightweight, ergonomic design allows you to operate the device with one hand, while the large, easy-to-read display and intuitive thumb navigation simplify work on production lines, warehouses or laboratories. The firmware includes basic industrial color scales and indexes, making the MiniScan EZ 4500L a universal solution for evaluating the color of fabrics, paper, powders, granules, and even liquids (when using a cuvette). The rugged design and AA batteries ensure mobility and long-term autonomy.	Equipment is necessary to implement the project.	7995738	1	7995738		50/50%	During the delivery period
AP27508635	Antimicrobial discs	sterile discs used to test microorganisms' sensitivity to antibiotics.	Equipment is necessary to implement the project.	3614	173	625222		50/50%	During the delivery period
AP27508635	Mueller Hinton Agar	Standard growth medium for testing bacterial susceptibility to antibiotics.	Equipment is necessary to implement the project.	30300	1	30300	-	50/50	During the delivery period
AP27508635	Buffered Peptone Water	Buffered Peptone Water is a liquid medium used for the pre-enrichment of microorganisms. It supports the survival of bacteria after stress conditions and promotes the recovery of pathogens, particularly Salmonella, prior to detection	Research within the project	37500	2	75000	-	50/50%	During the delivery period
AP27508635	Gram Coloring Kit	Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml) Цвет: синий, голубой, черный Состав: генциан-виолет (100 мл), раствор Люголя (100 мл) Volume: 0.2 L Color: blue, light blue, black Contents: gentian violet (100 ml), Lugol’s solution (100 ml)	Research within the project	11750	2	23500	-	50/50	During the delivery period
AP27508635	tip	1 ml (1000 µl) tip – transparent, PP material, autoclavable, 1000 pcs/package.	Research within the project	25950	2	51900	-	50/50%	During the delivery period
AP27508635	tip	Tips 200 µl – transparent, PP, autoclavable, 1000 pcs = 1 pack.	Research within the project	24500	1	24500		50/50%	During the delivery period
AP27508635	ChroMed E.coli агар, ChroMed E.coli агар, ChroMed E.coli Agar	ChroMed E.coli Agar, уп/100г , ChroMed E.coli Agar, pack/100g, ChroMed E.coli Agar уп/100г ,	Research within the project	42500	1	42500	-	50/50%	During the delivery period
AP27508635	Soy-casein Agar	Packaging type: polyethylene jar Unit of measurement: pack Pack size: 500 g	Research within the project	23000	1	23000	-	50/50%	During the delivery period
AP27508635	Light glass reaction jar with a blue screw-on plastic lid and 500 ml markings	Material: glass Type: Light glass reagent jar with blue screw-on plastic cap 500 ml with divisions Capacity 500 ml	Research within the project	3000	20	60000	-	50/50	During the delivery period

Барлығы: 13 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19178097	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Required for data analysis and systematic text work.	400000	2	800000	September	50/50%	During the delivery period

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP25796077	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Required for data analysis and systematic text work.	399990	2	799980	September	50/50%	During the delivery period
AP25796077	Infographic map	Format: Digital (PDF, PNG, SVG) and print version Size: A5 or B5 standards Content layers: historical data, chronological scale, legend symbols Graphic elements: charts, pictograms, map signs Visualization tools: Adobe Illustrator, CorelDRAW, Canva, or ArcGIS StoryMaps Color: full color (CMYK for print, RGB for digital), soft palette comfortable for viewing Design style: minimalist, focused on clear data presentation, with preserved contrast Fonts: suitable Cyrillic and Latin fonts for academic text (Arial, Times New Roman, Open Sans) Paper quality (for print): density 130–170 g/m², matte or glossy finish	It makes it possible to present research findings visually and convey the data clearly.	1	1	1	September	50/50%	During the delivery period

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР25796807	Laptop Lenovo Yoga Pro 7 14IMH9	Operating System: Windows 11 Home (x64) SL Processor: Intel Core Ultra 5 Processor Model: 125H Processor Frequency, GHz: 1.2 Integrated Processor Graphics: Intel Arc Graphics RAM Capacity, GB: 32 RAM Configuration: 32 GB (soldered on the motherboard) Number of RAM Slots: None Solid State Drive: 1 TB SSD Screen Size, inches: 14.5 Screen Resolution: 3072 x 1920	Purchase of a laptop for the material and technical base.	743386	1	743386	2025	50/50%	During the delivery period
АР25796807	Costs of work performed by outside organizations	Publication of an article in journals recommended by the Science and Higher Education Quality Assurance Committee of the Ministry of Science and Higher Education of the Republic of Kazakhstan	For the publication of a scientific research article within the framework of the project	56064	1	56064	2025	50/50%	During the delivery period
АР25796807	Scientific research service	Testing samples using the PCR method	PCR testing of samples collected within the framework of the project.	9843	150	1476450	September	100	During the delivery period

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP25796649	Scientific research service	Laboratory services for the determination of organoleptic, physico-chemical, biochemical, microbiological parameters, heavy metals and minerals.	To provide an experiment.	800	1	800	2025	50/50%	During the delivery period
AP25796649	Procurement of materials, equipment, and/or software	Milk	To provide an experiment.	500	200	100000	-	100%	During the delivery period
AP25796649	Procurement of materials, equipment, and/or software	Buttermilk	To provide an experiment	350	200	70000	-	100%	During the delivery period
AP25796649	Procurement of materials, equipment, and/or software	Dry serum	To provide an experiment.	800	50	40000	-	100%	During the delivery period
AP25796649	Procurement of materials, equipment, and/or software	Horse fat	To provide an experiment.	2500	20	50000	-	100%	During the delivery period
AP25796649	Procurement of materials, equipment, and/or software	Sea salt	To provide an experiment.	550	5	2750	-	100%	During the delivery period

Барлығы: 6 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23489475	hard drive	External hard drive Transcend, StoreJet 25H3 1TB HDD USB 1 TB TS1TSJ25H3P, USB3.0, ext., power via USB	The project requires an external hard drive for reliable storage and backup of large amounts of data, including 3D models, photo/video materials, and research archives. The device will ensure the security of information and the convenience of working with data in field and office conditions.	44	1	44	2025	50/50%	During the delivery period
АР23489475	Backpack	MarketOnline 504Blue trekking Backpack 50 L blue	Field work requires a trekking backpack adapted for long-term expeditions and carrying heavy equipment. It will provide comfort, even load distribution and protection of the contents in difficult natural conditions.	17	1	17	2025	50/50%	During the delivery period
АР23489475	Шпатель / Шпатель / spatula	Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field.	Archaeological excavations require a specialized trowel designed for precise stripping of the cultural layer and processing of small details. The use of the tool will ensure the accuracy of the work, the safety of the finds and the high accuracy of research in the field.	6	1	6	2025	50/50%	During the delivery period
АР23489475	Sleeping bag	Fleece sleeping bag-liner single tourist	Archaeological expeditions require a sleeping bag to keep participants working, regardless of weather conditions and temperature.	5	1	5	2025	50/50%	During the delivery period
АР23489475	Tent	High Peak Minilite 2 Tent blue	a tent for ensuring the protection of field workers from adverse weather conditions and the convenience of living in the field	25	1	25	2025	50/50%	During the delivery period
АР23489475	Gloves	work gloves	Archaeological work requires protective gloves, which will ensure the safety of hands when working with tools, finds and soil. They will help to avoid injury, contamination and provide convenience in the field.	72	1	72	2025	50/50%	During the delivery period
АР23489475	Bayonet shovel	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	3	1	3	2025	50/50%	During the delivery period
АР23489475	Shovel	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	Archaeological expeditions require a bayonet shovel designed to carry out excavation work, including removing topsoil and clearing excavation sites. This tool ensures efficiency and accuracy when working with soil in the field.	3	1	3	2025	50/50%	During the delivery period

Барлығы: 8 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР2З484846	Laboratory research	Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine + isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) by capillary electrophoresis Determination of fatty acid composition by GLC Determination of the mass fraction of fiber Determination of the amount of vitamins E (α, β, γ, δ) by HPLC Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by capillary electrophoresis Determination of the amount of β - carotene Determination of fat-soluble antioxidants Determination of water-soluble antioxidants Determination of iron Determination of zinc Determination of magnesium Determination of calcium Determination of phosphorus Determination of iodine in 1 sample	Required for the completion of the research project	168300	1	168300	june	50/50%	During the delivery period
АР2З484846		Horse meat-20 kg * 3700 = 74000 tenge turkey meat-5 kg2400 = 12000 tenge chicken fillet-5 kg2000 = 10000 tenge beef - 120 kg * 4000 tenge = 480000 tenge Lamb - 20 kg * 3700 = 74000 tenge tail fat - 10 kg * 4000 = 40000 tenge green buckwheat - 10 kg * 1200 tenge= 12000 tenge wheat flour 10 kg * 360 tenge = 3600 tenge	Conducting laboratory work in accordance with the calendar plan	705600	1	705600	november	100%	Delivered

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992981	Services for rent	Housing rental services for field expeditions	Necessary to perform calendar tasks of the Program	2624000	1	2624000	may	50/50%	During the delivery period
BR24992981	Scientific research service	Training course on the use of geoinformation system ESRI ArcGIS	The service is necessary for the implementation of the Program.	842800	1	842800	may	50/50%	During the delivery period
BR24992981	Scientific research service	Conducting a sociological study of the current state of recreational tourism in Kazakhstan, including the Alakol region, and its importance, as well as general tourism services and their quality. Conducting sociological research on the effective use of the balneological resources of the Barlyk-Arasan resort and the state of resort medicine	This service is necessary to perform calendar tasks of the Program	12000000	1	12000000	july	50/50%	During the delivery period
BR24992981	Providing servicese	Chemical, biochemical, microbiological analysis of the composition of mineral waters and medicinal mud of the Alakol basin	Necessary to perform calendar tasks of the Program	1736000	1	1736000	-	50/50%	During the delivery period

Барлығы: 4 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP19579443	Спектрофотометр СФ-2000	The spectrophotometer is designed to measure the spectral coefficients of directional transmission of liquid and solid transparent samples. The detectors are CCD rulers with high sensitivity and resolution parameters. The high-speed USB communication interface with the computer provides fast bidirectional data exchange with the computer, increasing operator comfort.	The device is necessary for conducting research to determine the ratios of polymers in the initial mixture to be applied to the soil.	3591800	1	3591800	Май-декабрь	30/70%	Delivered
AP19579443	Стимулятор роста растений	YaraVita BioNUE™ Plant Growth Stimulation Solution	It is necessary for conducting pilot tests of the technology.	264000	1	264000	Май-июнь	100%	Delivered
AP19579443	Стимулирующий раствор для роста растений	Plant Growth Stimulation Solution TRAINER"	It is necessary for conducting pilot tests of the technology."	200550	1	200550	Май-июнь	100%	Delivered
AP19579443		Nitroammophoska. Complex fertilizers for plant growth and development	It is necessary for conducting pilot tests of the technology.	12250	1	12250	Май-июнь	100%	Delivered
AP19579443	Удобрение	YaraTera KRISTALON 12-12-36 RED	It is necessary for conducting pilot tests of the technology.	124875	1	124875	Май-июнь	100%	Delivered
AP19579443	Удобрение	Ammonium nitrate	It is necessary for conducting pilot tests of the technology.	27750	1	27750	Май-июнь	100%	Delivered
AP19579443	Monoblock Acer Aspire 27"	Моноблок Acer Aspire C27-2G (Black)/ Intel Core i5 13420h/ 32 ГБ DDR4 3200/ 512 ГБ M.2 NVME SSD/ 27"FullHD IPS non-touch/ 802.11axWiFi6+BT5.0/ беспроводные Kb+M/ Windows 11 + Office LTSC Standard 2024	Purchase of a monoblock for the material and technical base	500000	3	1500000	September	50/50%	During the delivery period
AP19579443	3.0 kW heating element	spare part for the Livam AE-4 distiller	To prepare water for work	42237	2	84474	September	100	During the delivery period
AP19579443	ADS Multi Acid Decomposition System	The system is designed for sample preparation of samples for elemental analysis: the material of the heating unit is graphite with Teflon coating, The number of tubes to be installed in one heating unit is 16 for 100 ml and 9 for 50 ml. Heating temperature - 250 C, The power is not more than 3.2 kW.	The device is necessary to prepare soil samples for chemical analysis.	3000000	1	3000000	-	50/50%	During the delivery period

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992916	High cross-country ability in off-road conditions, large capacity). The Stone Age Study Group.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	During the delivery period
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity)	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	During the delivery period
BR24992916	motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Early iron age	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	During the delivery period
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Monument vault squad.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	2000000	1	2000000	may december	70/30%	Delivered
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). A group for the study of Early Iron Age settlements.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1400000	1	1400000	may-december	70/30%	During the delivery period
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). The group for the study of burial mounds of the elite of the Early Iron Age.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1400000	1	1400000	may-december	70/30%	During the delivery period
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity). Ethno-archaeological group.	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1200000	1	1200000	may-december	70/30%	During the delivery period
BR24992916	Motor transport (UAZ or SUV. High cross-country ability in off-road conditions, large capacity).Exploration Squad (Medieval times)	Off-road vehicle. It provides reliable movement along dirt roads, steppe areas and areas with high humidity, including wetlands. It is stable when moving on slopes and in conditions of transverse inclination. It is equipped (if available) with reinforced engine and chassis protection elements, which increases its reliability when operating in difficult road conditions.	For the successful implementation of an archaeological expedition within the framework of the project, conducting field research in remote and hard-to-reach areas requires reliable and specialized transport. Rental of transport is a necessary and reasonable expense item for the following reasons: transportation of expedition members; delivery of equipment and materials; ensuring mobility in the excavation area, etc.	1000000	1	1000000	may-december	70/30%	During the delivery period
BR24992916	Monograph by Samashev Z.""The visual activity of the ancient population of the Kazakh	Technical specifications of the publication: Format: 84 × 108 1/16 Volume: 300 pages Block printing: full color (4+4 cr.) Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: one-sided printing (4+0 gr.), lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies	The publication of the monograph of the Doctor of Historical Sciences, Professor Zainolla Samashev "The visual activity of the ancient population of the Kazakh Altai" is a significant contribution to the development of national and world archaeological science. The work is based on many years of archaeological research conducted in the region of Eastern Kazakhstan, rich in unique rock art monuments.	3491100	1	3491100	may-december	50/50%	During the delivery period
BR24992916	Monograph by Oshanov O. "Kazakh agricultural calendar".	Technical specifications of the publication Monograph: Oshanov O. ""Kazaktyn sharuashylyk kuntizbesi"" Format: 84 × 108 1/16 Volume: 380 pages Block printing: full-color, 4+4 colors Block paper: coated, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Binding design: 4+0 cu., lamination, foil stamping Coated paper, density 150 g/m2 Circulation: 300 copies	O. Oshanov's monograph "Kazaktyn sharuashylyk kuntizbesi" is devoted to a little-studied but extremely important aspect of the traditional culture of the Kazakh people - the system of economic and calendar knowledge. It explores the historical and ethnographic basis of the national calendar, its connection with the cycles of nomadic economy, natural rhythms and rituals reflecting the way of life of Kazakhs for centuries.	3870000	1	3870000	may-december	50/50%	During the delivery period
BR24992916	Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum.	Technical specifications of the publication Publication: Catalogue of archaeological collections of Kazakhstan. According to the collections of the regional museum Format: 70 × 100 1/8 (book) — 24.5 × 29 cm (height) Volume: 416 pages Block printing: full color (4+4 colors) Coated paper, density 115 g/m2 Flyleaf: 4+0 sheets, offset paper, density 160 g/m2 Binding: hard, type No. 4 Decoration: 4+0 gr., lamination, foil stamping Binding paper: coated, density 150 g/m2 Circulation: 300 copies	The publication of the Catalog of Archaeological Collections of Kazakhstan is a fundamental scientific reference work, including a systematic description of artifacts stored in the collections of the museum of the Abai region. The catalog provides an opportunity for a comprehensive analysis and study of archaeological finds reflecting various stages of historical development in Kazakhstan.	4257000	1	4257000	may-december	50/50%	During the delivery period
BR24992916	Earthworks. Medieval Monuments Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Medieval monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the medieval period on the territory of Kazakhstan, namely the Abai region.	4500000	1	4500000	may-december	70/30%	During the delivery period
BR24992916	Earthworks. The Early Iron Age Study Group.	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region.	11550000	1	11550000	may-december	70/30%	During the delivery period
BR24992916	Excavation team for the study of the Early Iron Age.	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 22 people. Duration of work: 35 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the detachment for the study of monuments of the Early Iron Age is an integral part of archaeological field research aimed at studying the material heritage of the Early Iron Age on the territory of Kazakhstan, namely the Abai region.	11550000	1	11550000	may-december	70/30%	During the delivery period
BR24992916	Earthworks. Early iron age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	june-december	70/30%	During the delivery period
BR24992916	Earthworks. The Bronze Age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	июнь-декабрь	70/30%	During the delivery period
BR24992916	Earthworks. The Bronze Age Study Group	Type of work: Land work (archaeological excavation work). Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Bronze Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Bronze Age in Kazakhstan, namely the Abai region.	4500000	1	4500000	june-december	70/30%	During the delivery period
BR24992916	Earthworks. The Stone Age Study Group	Type of work: Land work (archaeological excavation work).Purpose: To ensure the conduct of archaeological excavations, preparation of the territory for research, excavation, excavation work. Number of workers: 10 people. Duration of work: 30 days. Location: Abai region. Result: Processing and preparation of the territory for archaeological research; Preparation and excavation of the ground within the established excavation boundaries, execution of instructions from the head of the detachment and the scientific staff of the expedition.	The excavation work carried out by the Stone Age Monuments unit is an integral part of archaeological field research aimed at studying the material heritage of the Stone Age on the territory of Kazakhstan, namely the Abai region.	4500000	1	4500000	июнь-декабрь	70/30%	During the delivery period
BR24992916	Soil analysis is a comprehensive characteristic of the entire diversity of microbiomorphs in samples and the features of their profile distribution.	Determination of the morphological, taxonomic, and quantitative composition of microbiomorphs (microfossils, phytoliths, spore-pollen residues, diatoms, etc.) in soil samples, taking into account the stratigraphic distribution. The result: Photofixation of microbiomorphs, Tables of distribution and quantity over the horizon, Graphs of profile distribution, Interpretation by type of soil formation, biogenic activity, climatic conditions, etc.	This analysis includes specialized sample processing, visualization of microbiomorphs using optical methods, their profile differentiation and subsequent analytical interpretation, which requires the involvement of qualified specialists and the use of appropriate laboratory equipment.	106260	1	106260	июнь-декабрь	100%	During the delivery period
BR24992916		Isotopic analysis of ceramics (food remains): definition of the paleodiety and dating of the object. Type of samples: Fragments of ceramic vessels and whole vessels. The result: Chemical and isotopic composition of organic residues, Reconstruction of the type of food and household structure, If possible, absolute dating (in radiocarbon and calibrated years), a scientific report with photofixation, tables, diagrams and interpretation of the results, etc.	Isotopic analysis of organic remains on ceramics is one of the leading interdisciplinary methods in archaeology, which allows: to determine the composition and origin of food prepared or stored in vessels; to identify the sources of nutrition of the ancient population (plant, animal food, marine or freshwater resources); to reconstruct the paleodiety and food preferences; to establish the cultural and economic characteristics of a particular an archaeological group or period.	295789	1	295789	июнь-декабрь	100%	During the delivery period
BR24992916	Isotopic analysis of archaeozoological material (animal bone).	Isotopic analysis of archaeological material (animal bone). Type of analyzed material: bones of different animal species. Analysis results: Isotopic parameters δ13C and δ1⁵n for each sample, Group interpretation: habitat, diet, seasonality, Determination of the economic role of animals (cattle breeding, hunting), Report with tables, graphs and scientific interpretation of data (optional) – calibrated date by radiocarbon, etc. Isotopic analysis of archaeological material (animal bone). Type of analyzed material: bones of different animal species. Analysis results:	Isotopic analysis of animal bones extracted during archaeological excavations is a key method of: paleoecological habitat of animals; diet and food chain, including the difference between wild and domestic species; types of land use and grazing strategy of the ancient population; migrations of animals and, consequently, possible movements of people. The study of stable isotopes of carbon (δ13C), nitrogen (δ1⁵n), oxygen (δ1⁸o) and strontium (⁸⁷SR/⁸⁶SR) in bone tissue allows us to recreate a detailed picture of the natural and economic conditions of ancient communities.	431786	1	431786	июнь-декабрь	100%	During the delivery period
BR24992916	Isotopic analysis of anthropological material (human bone).	Isotopic analysis of human bone remains is one of the most informative methods for studying the paleodiety, mobility, and social stratification of ancient populations. Type of samples: skeletal remains of human individuals. Result: Values of δ13C, δ1⁵n — information about the diet (meat/vegetable food, marine/freshwater diet), Values of ⁸⁷SR/⁸⁶SR and δ1⁸o - geographical reference (migration, region of residence), (if necessary) - absolute radiocarbon date (in BP and calibrated years), Scientific report with tables, graphs and interpretation of the results.	Isotopic analysis of human bone remains is one of the key methods for reconstructing the lifestyle, nutrition, migrations, and environmental conditions of the ancient population. By studying stable isotopes of carbon (δ13C), nitrogen (δ1⁵n), oxygen (δ1⁸o) and strontium (⁸⁷SR/⁸⁶SR), researchers can obtain information about: Paleodiety - determination of protein sources (plant/animal food, marine/terrestrial), differences in gender, age and social status; Ecological and economic strategies - hunter-gatherers, pastoralists, farmers; Geographical origin and mobility of individuals - due to the analysis of oxygen and strontium isotopes in tooth enamel and bone tissue; Social stratification and ritual practices related to nutrition or ancestry.	431786	1	431786	июнь-декабрь	100%	During the delivery period
BR24992916	Primary conservation and restoration of discovered finds.	Primary conservation and restoration of discovered archaeological finds. Types of processed materials: Metals (bronze, iron, copper, silver, gold), Ceramics (ceramic vessels, fragments, fragments), Stone (ornamented or worked stones), Organic materials (bone, wood, leather, textiles, plants), glass, etc. The result of the work: Preservation of the historical value of the finds, Preparation of objects for further scientific research, Preparation for an exhibition or transfer to museum collections, a scientific report describing the condition of objects, restoration methods and condition after work, etc.	Primary conservation and restoration are an integral stage of archaeological research and include: Stabilization of the state of finds to prevent destruction; Mechanical and chemical cleaning of impurities and salts; Fixing and strengthening fragments, including joining crumbled objects; Preparation of objects for further storage, research and museum exposition. Without timely primary processing, many objects lose their scientific value and may be lost.	431786	1	431786	июнь-декабрь	100%	During the delivery period
BR24992916	Radiocarbon analysis To obtain the absolute age of the monument (bone, collagen).	Radiocarbon dating: obtaining the absolute age of the monument (bone, collagen). Type of samples: Human or animal bones. Analysis results: The absolute date of the object or layer in calibrated years, taking into account the error. An indication of potential limitations related to calibration or the condition of the sample. A scientific report with photofixation, graphs and tables, as well as possible conclusions based on the dating results. The result of the work: Obtaining accurate dating (in calendar years) for archaeological sites, burials or objects. Using radiocarbon dating to synchronize with other dating methods and analyze cultural layers.	Radiocarbon dating (14C) is one of the most accurate and widely used methods for obtaining an absolute chronology of archaeological sites. In the case of animal or human bone analysis, the main source for dating is collagen, an organic protein that is resistant to postdepositional changes with good preservation. Conducting a 14C analysis allows you to: Establish the absolute age of an archaeological site or cultural layer; Link certain finds to a specific historical period; Clarify the chronological framework of the monument's existence, building stages, burials, etc.; Use the data in a comparative analysis with other monuments in the region. The results of radiocarbon dating are an important part of scientific interpretation and are mandatory in preparation for publications and museum catalogues.	221428	12	2657136	июнь-декабрь	100%	During the delivery period

Барлығы: 24 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23488882	Monoblock	27" Моноблок Моноблок Monoblock 27 Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional	Purchase of monoblocks for the opening of the Academic writing center	465455	1	465455	may	100%	Delivered
АР23488882	Speaker	Frequency range 80-18000 Hz	Purchase of a speaker for working with electronic educational resources	9788	1	9788	may	100%	During the delivery period
АР23488882	polygraphy services	Publication of the manual	development of students' academic writing skills in English	4000	100	400000	may	100%	Delivered
АР23488882	polygraphy services	Publication of the manual	development of students' academic writing skills in English	4000	100	400000	may	100%	Delivered
АР23488882	polygraphy services	publication of the monograph	Systematization and dissemination of knowledge gained during the project implementation process	4500	100	450000	may	100%	During the delivery period
АР23488882	polygraphy services	publication of an analytical review	Dissemination of information on the research topic	2500	50	125000	may	100%	During the delivery period
АР23488882	polygraphy services	Assigning an ISBN code	Identification of book publications	11000	4	44000	may	100%	Delivered
АР23488882	The MLS400 Residual Current Device	The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts.	needed for the completion of the project	1600000	1	1600000	may	50/50%	Delivered

Барлығы: 8 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992914	Scientific research service	1. Research on the production of biohydrogen, bioethanol, and biobutanol from distillery waste, coffee, their various mixtures, fruit waste and their mixtures with glycerol and coffee using different bacteria. 2. Study of changes in metabolic properties and pathways in wild-type S. cerevisiae (W303-1B) and mutant strains (Δhap4, ρ0) under fermentation and respiration conditions at different external pH levels and carbon sources.	The service is necessary to complete the project.	10000000	1	10000000	april	50/50%	Delivered
BR24992914	Scientific research service	- Conducting research on the use of hydrogen for the extraction of valuable organic compounds from lignocellulosic materials. - ⁠Conducting research on the analysis of total phenolic content, flavonoids, anthocyanins, beta-carotene, chlorophyll a and b, as well as phenolic profile, organic acid profile, sugar profile, and vitamin C content	The service is necessary to complete the project.	6000000	1	6000000	april	50/50%	Delivered
BR24992914	Scientific research service	Study of substance composition: analysis of sugars by HPLC, organic acids, and other components	The service is necessary to complete the project.	988000	1	988000	may	50/50%	Delivered
BR24992914	Scientific research service	Conducting research and development of new bifunctional materials for capturing and processing by-products from molecular hydrogen production: synthesis of activated carbon from plant waste, testing the resulting material as a sorbent for carbon dioxide (CO₂) capture, determining CO₂ sorption capacity, and studying the main CO₂ sorption sites using temperature-programmed desorption (TPD-CO₂) method	The service is necessary to complete the project.	5000000	1	5000000	may	50/50%	Delivered
BR24992914	Scientific research service	Modernization and update of the scientific program website	The service is necessary to complete the project.	130000	1	130000	May	50/50%	Delivered
BR24992914	Scientific research service	Provision of the service for preparing and filing a utility model patent application	The service is necessary to complete the project.	400000	1	400000	may	50/50%	Delivered
BR24992914	Cuvette test COD, measuring range 5–60 mg/l, 25 tests LCK1414	For measuring low concentrations of COD	Needed for photometric analysis required to evaluate experimental results	178000	1	178000	-	50/50%	During the delivery period
BR24992914	COD cuvette test measuring range 100–2000 mg/l, 25 tests LCK514	For analyzing medium COD concentrations	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	181000	During the delivery period
BR24992914	COD Test’N Tube, measuring range 200–15000 mg/l, 150 tests 2415915	For determining high COD concentrations	Needed for photometric analysis required to evaluate experimental results	595000	1	595000	-	50/50%	During the delivery period
BR24992914	LCK338 Laton Total Nitrogen cuvette test 20–100 mg/l, 25 tests LCK338	For measuring total nitrogen in water samples.	Needed for photometric analysis required to evaluate experimental results	225000	1	225000	-	50/50	During the delivery period
BR24992914	Phosphate (ortho/total) cuvette test measuring range 0.05–1.5 mg/l PO₄-P, 25 tests LCK349	For precise determination of low concentrations of ortho- and total phosphate	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	During the delivery period
BR24992914	Phosphate (ortho/total) cuvette test measuring range 2.0–20 mg/l PO₄-P, 25 tests LCK350	For analyzing higher concentrations of ortho- and total phosphate	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	During the delivery period
BR24992914	Organic Acids cuvette test measuring range 50–2500 mg/l, 25 tests LCK365	For determining organic acid content	Needed for photometric analysis required to evaluate experimental results	181000	1	181000	-	50/50%	During the delivery period
BR24992914	Dipotassium phosphate trihydrate (K₂HPO₄·3H₂O, hydrated)	A white crystalline powder, highly soluble in water. The aqueous solution is slightly alkaline. Molecular weight: 228.22 g/mol.	Buffering agent, stabilizer, used in laboratories and microbiological media.	250000	1	250000	-	50/50	During the delivery period
BR24992914	Peptone (meat-based), AR Grade/GR (500 g)	А product of partial enzymatic breakdown of animal protein (usually of meat origin), which is a light beige powder, highly soluble in water, of AR Grade / GR purity class, suitable for microbiological and biochemical research.	Required for biochemical and microbiological research	90000	1	90000	-	50/50	During the delivery period
BR24992914	Bacteriological agar (agar-agar), AR Grade/GR (500 g)	A naturally occurring polysaccharide isolated from red algae (Rhodophyceae). Appearance: Light beige granules or powder, odorless. Solubility: Soluble in hot water, forms a strong gel upon cooling. Purity: AR Grade / GR – analytical and guaranteed purity, suitable for microbiological and biochemical research.	Required for biochemical and microbiological research	252000	1	252000	-	50/50	During the delivery period
BR24992914	Sodium carbonate (Na₂CO₃)	An inorganic compound that is a white crystalline powder, highly soluble in water, with an alkaline reaction; it is used as an analytical grade reagent (AR Grade / GR) in laboratory, microbiological, chemical and food analysis for the preparation of buffer solutions, acid neutralization, titrimetric determinations and pH regulation of the environment.	Necessary for the preparation of buffer solutions, neutralization of acids, titrimetric determination and regulation of pH of the medium.	43000	1	43000	-	50/50	During the delivery period
BR24992914	Folin–Ciocalteu reagent (indicator), 500 mL	A bluish-green chemical reagent, a mixture of phosphomolybdic and phosphotungstic acids, used as a redox indicator in biochemical and analytical studies. It is used for the quantitative determination of phenolic compounds, amino acids, and proteins (e.g., in the Lowry method, for determining total polyphenol content using Gall or Gallic acid).	Required for quantitative determination of phenolic compounds, amino acids and proteins	180000	1	180000	-	50/50	During the delivery period
BR24992914	Aluminum chloride (AlCl3) (1 kg)	An inorganic compound that appears as white or slightly yellowish crystals, highly soluble in water, ethanol, and other polar solvents. It is highly hygroscopic and has an acidic solution. It is used as an analytical-grade reagent (AR Grade/GR) in laboratory, chemical, and biochemical analyses.	Required for biochemical and microbiological research	47000	1	47000	-	50/50	During the delivery period
BR24992914	Aluminum chloride (AlCl₃), 1 kg/Sodium acetate (CH₃COONa), anhydrous, 1 kg	Anhydrous is an inorganic compound that is a white, odorless, crystalline powder (or granules), highly soluble in water, alcohols and glycerin, with a slightly alkaline reaction, a molecular weight of 82.03 g/mol	Required for biochemical and microbiological research	109000	1	109000	-	50/50	During the delivery period
BR24992914	Potassium-sodium tartrate tetrahydrate, analytical grade, EMSURE® ACS, ISO, Reag. Ph Eur (100 mL)	A crystalline inorganic compound that appears as colorless or white crystals, readily soluble in water, with a neutral or slightly alkaline reaction; it is used as a reagent of high analytical purity (meets the requirements of ACS, ISO, and the European Pharmacopoeia)	Required for biochemical and microbiological research	135000	1	135000	-	50/50	During the delivery period
BR24992914	Glucose, 500 g	An organic compound that is a white crystalline powder with a sweet taste, highly soluble in water, belonging to the monosaccharides (aldehyde alcohols); it is used in biochemical, microbiological and analytical studies as a source of carbon and energy, as well as in nutrient media, fermentation processes and standard solutions due to its high purity (AR Grade / GR).	Required for biochemical, microbiological and analytical research.	18740	1	18740	-	50/50	During the delivery period
BR24992914	Sodium hydroxide (NaOH)	А white crystalline substance with a strong alkaline reaction, highly soluble in water, used as an analytical-grade reagent for neutralizing acids and preparing solutions in chemical and biochemical analysis.	Required for biochemical and microbiological research	15000	1	15000	-	50/50	During the delivery period
BR24992914	Potassium hydroxide (KOH)	A white crystalline substance with a strong alkaline reaction, readily soluble in water and alcohols; used as an analytical-grade reagent for neutralizing acids and preparing buffer solutions.	Required for biochemical and microbiological research	71840	1	71840	-	50/50	During the delivery period
BR24992914	Yeast extract	A nutrient component in the form of a light beige powder, highly soluble in water; used as a source of amino acids, vitamins, and growth factors in microbiological nutrient media.	Required for biochemical and microbiological research	78000	1	78000	-	50/50	During the delivery period
BR24992914	Potassium dichromate (K₂Cr₂O₇), Extra Pure	Orange-red crystals, highly soluble in water; strong oxidizing agent, used as a high-purity reagent (EXTRA PURE) in analytical chemistry, titrimetry and photometry	Required for biochemical and microbiological research	64000	1	64000	-	50/50	During the delivery period
BR24992914	Storage cabinet MD 4-800	Reagent storage cabinet, W800 x D400 x H1750 + 100 + 70 mm: The cabinet is made of steel, with a 0.6 mm thick frame and 0.7 mm thick door. The door is equipped with key locks (one is installed on the top and one on the bottom door). The handle is plastic (125 mm). The maximum load on the metal shelf is 30 kg. There are two shelves in the upper section and two shelves in the lower section. The shelves are perforated for ventilation. A 100 mm diameter metal pipe is attached to the top. The lower part of the rear wall is equipped with ventilation holes.	Required for storing chemical reagents	460000	1	460000	-	50/50	During the delivery period

Барлығы: 27 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP23485629	A test kit for determining the antibiotic in meat and milk	The test kit is designed for rapid and accurate detection of antibiotic residues in meat and milk, including tetracyclines, beta-lactams, streptomycin, chloramphenicol, and sulfonamides. It offers high sensitivity, is easy to use, and suitable for both laboratory and field applications.	Research within the project	4041401	1	4041401	may	50/50%	Delivered
AP23485629	Chromatographic column	Research within the project	A chromatographic column is intended for the separation and quantitative analysis of antibiotics using liquid chromatography. The column is a cylindrical tube packed with a stationary phase (sorbent), through which a mobile phase (eluent) is passed. Due to the interaction between antibiotics and the sorbent, effective separation is achieved, enabling accurate determination of their quantitative levels in the analyzed samples.	1	1	1	may	50/50%	Delivered
AP23485629	Fridge	Temperature range: +2…+8 °C Volume: 300 L Cooling system: static Control: electronic with display Body: metal, inner chamber — ABS/stainless steel Shelves: adjustable Alarm system: temperature, door, power supply Power supply: 220 V, 50 Hz Additional features: lock, temperature recording, emergency power supply	Research within the project	300	1	300	may	50/50%	Delivered
AP23485629	Standard sample for Akvilon AKV-07MK (set)	Purpose: Calibration and testing of the Akvilon AKV-07MK gas analyzer Set includes: cylinders with standard gas mixtures, pressure regulator, connection hoses, certificate Gas types: methane (CH₄), propane (C₃H₈), butane (C₄H₁₀), others upon request Cylinder volume: 1–5 L (depending on configuration) Pressure: up to 150 atm Composition accuracy: ±2% Storage conditions: +5…+25 °C, dry environment Shelf life: up to 2 years	Research within the project	801	1	801	may	50/50%	Delivered

Барлығы: 4 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР19680287	Automatic press for mounting metallographic samples МР-3000	The DTQ-5 model with low cutting speed is suitable for precise cutting of various hard materials, especially for all kinds of small metal, non-metal parts and various electronic components. Specifications: Positioning accuracy: 0.01mm; Rotation speed: 0-700rpm; Blade diameter: Ø100 - 150mm; Power: 220V/110V, 50Hz; Dimensions: 350x350x200mm; Weight: 18.5kg.	As part of the implementation of this project, a study is being conducted on the effect of local electrolytic plasma hardening (EPH) on the structure and properties of steel parts of a freight car bogie. For a detailed analysis of the structure of the hardened layer, it is necessary to conduct metallographic studies that require the preparation of high-quality sections. One of the critical stages of preparation is the precise and accurate cutting of samples from large and hard metal parts. This requires the use of specialized cutting equipment that ensures precision cutting without overheating and deformation of samples. The optimal solution is the DTQ-5 cutting machine, which will allow you to prepare samples with high accuracy, efficiency and safety.	1	1	1	april	50/50%	Delivered
АР19680287	Metallographic grinding and polishing machine LMP-3S	LMP-3S is a multifunctional equipment designed for preparing metallographic samples. It combines preliminary grinding, coarse and fine grinding, as well as coarse and fine polishing. The machine features a powerful motor, low noise level, high reliability and ease of operation, which makes it an ideal choice for industrial enterprises and research organizations. Working disk diameter - 250 mm Working disk speed - 50-1000 rpm (smooth adjustment), fixed speeds: 400/600/800/1000 rpm Direction of rotation - clockwise and counterclockwise Speed of grinding/polished head - 5-10 rpm (smooth adjustment) Number of samples processed simultaneously - 6 pcs. Load range – 0-0.7 MPa (adjustable, factory setting ≤ 0.2 MPa Sample preparation time – 0-3000 seconds Sample diameter – 30 mm Input voltage – single-phase 220 V ± 10%, 50-60 Hz Total power – 900 W Overall dimensions – 790 x 740 x 700 mm Weight (net) - 89.6 kg	The hardened layer after EPU has a complex structure, requiring high-quality surface preparation for correct analysis. The LMP-3S machine allows you to get a perfectly smooth surface without artifacts. The automated grinding and polishing process ensures the same processing parameters for all samples, eliminating the influence of the human factor. Manual sample preparation takes a lot of time and requires highly qualified operators. The LMP-3S significantly speeds up the process due to automatic control of pressure, speed and processing time.	3	1	3	april	50/50%	Delivered
АР19680287	Automatic feeding system for dosing and polishing 2T	The 2T Automatic Polishing Feed System is a device that integrates a precise peristaltic pump, touch screen display and intelligent liquid feed control. The device automatically adjusts the feed intervals and power, ensuring uniform distribution of grinding and polishing suspension in the required volume and at a given speed. Model - 2T Liquid bottle capacity - 500ml*2 Control and display - touch screen Natural motor - DC motor Power - 200V, 50Hz Size - 210x280x260mm	The purchase of the system is justified by the need to improve the accuracy and efficiency of the polishing process for steel parts of a freight car bogie when preparing their surface for analysis after local electrolytic-plasma hardening. Automatic supply of suspensions allows for precise control of the amount and uniformity of application of the polishing material, reducing the likelihood of human error and ensuring process stability. This improves the quality of the final polishing, which is critical for obtaining reliable data in microstructural analysis and assessing the properties of hardened parts.	540	1	540	april	50/50%	Delivered
АР19680287	Medical electric water distiller type AE according to TU 9452-01-22213860-2009 in the version: AE-10/20 (with a built-in water collector)	Production of distilled water of type 3 according to GOST R 58144-2018 ""Distilled water"", FS.2.2.0019.18 ""Water for injection"" Productivity - 10 l / h Volume of water separator - 20 l Cooling water consumption - 75 l / h Source water pressure - 0.1 ... 0.4 MPa Specific conductivity of water at the outlet 2 ... 2.5 μS / cm Temperature of produced water - 24 ... 40 ℃ Power supply - 380 V, 50 Hz Power consumption - 7.2 kW Dimensions - 425x425x775 mm Weight - 22.8 kg Water purification coefficient from radionuclides is not less than 4000 Average service life - 10 years	The project requires distilled water, which is the main component of electrolytes used in the process of local electrolytic-plasma hardening. The new premises do not have a distiller, which complicates the research. The purchase of AE-10/20 is necessary for the uninterrupted conduct of experiments and increasing the efficiency of the laboratory.	617	1	617	april	50/50%	Delivered
АР19680287	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	400000	5	2000000	april	50/50%	During the delivery period
АР19680287	Flat Corrosion Cell CS936	The CS936 flat corrosion cell is designed for electrochemical corrosion studies on flat samples. It provides a working area of 1 cm² and can be equipped with a jacket for water circulation, which allows temperature control during experiments. The kit includes: Reference electrode Ag/AgCl Counter electrode: platinum mesh 20x20 mm This cell is compatible with various electrochemical instruments and is suitable for accurate and reliable measurements in the field of corrosion studies.	To study the corrosion resistance of hardened parts, the project requires electrochemical testing. Under current conditions, sample preparation takes a significant amount of time: it is necessary to make contact and coat the surface with varnish. Simplification of work - the sample is simply installed in the cell without additional preparation. Standard contact conditions ensure reproducibility of results. Reduction of time costs - accelerates the research process, improving their efficiency. Purchase of CS936 will optimize corrosion tests, reduce preparation time and improve the quality of results.	350	1	350	april	50/50%	Delivered
АР19680287	Analytical laboratory scales ADAM HCB	Maximum weighing capacity (MWC), g: 120 Readability, g: 0.001 Dimensions (W×D×H), mm: 172×251×75 Weight, kg: 2	The project requires high-precision equipment to carry out accurate measurements of sample mass. ADAM HCB analytical laboratory scales will provide the necessary accuracy and stability in measurements, which is critical for the correctness of all experimental data.	340	1	340	april	50/50%	Delivered
АР19680287	Sanding paper	Diameter: 250 mm Grit size: 100–2500	The sample preparation for this project requires the use of abrasive papers with different grits to ensure the required surface quality for subsequent metallographic analysis. Different paper grits allow for efficient grinding at different stages of sample preparation, from rough grinding to final polishing.	580	1	580	april	50/50%	Delivered
АР19680287	Epoxy resin for embedding samples	Epoxy resin for embedding samples for SEM	To prepare samples of steel parts of a freight car bogie subjected to local electrolytic-plasma hardening, epoxy resin is required for their pressing before conducting metallographic analysis. This will ensure stability and convenience during processing and research. Epoxy resin has excellent adhesion and strength, which guarantees reliable fixation of samples and their protection from damage during grinding and polishing.	210	1	210	april	50/50%	During the delivery period

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР19579513	Automatic press for mounting metallographic samples MP-3000	Mold diameter – 30 mm Parameter programming – programmable database, up to 99 assembly methods maximum number of samples – 2 pcs. per cycle Heater power – 2000 W Temperature range – 0-200℃ (adjustable) Heating time range – 0-30 minutes Pressure range 0-6 MPa (adjustable) Total assembly time – 6 min Pressure mode – automatic (electro-hydraulic system) Cooling system – automatic water cooling Control type and display – 7-inch touch screen Operating mode – automatic/manual Power consumption – 2200 W Power supply – AC 220V, 50Hz Dimensions/weight – 630x520x480 mm, 120 kg	The project includes a study of the structure and properties of surface-hardened stainless steel parts. This requires metallographic analysis, which requires the preparation of high-quality sections. One of the key stages of preparation is the installation of samples in polymer molds, which ensures the convenience of their subsequent processing and analysis.	4401140	1	4401140	april	50/50%	Delivered

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23488875	Monoblock	27" Full HD, Intel Core i5, 16ГБ DDR4, 512ГБ SSD, Windows 11 Professional	Procurement of all-in-one computers for the establishment of an academic writing center	569000	1	569000	may	100%	Delivered

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP23488216	Magnetic stirrer	Asynchronous/Synchronous control mode. The maximum volume is 6 500 ml places. Max. temperature is 120 ℃. The mixing speed is from 50 to 1200 rpm. The size of the platform for 1 seat is 110 mm. Dimensions 43022065 mm. Weight 6.5 kg. The manufacturer is China.	Mixing solutions and suspensions during scheduled experiments.	791828	1	791828	September	50/50%	During the delivery period
AP23488216	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base	400000	1	400000	may	50/50%	During the delivery period
AP23488216	Multifunctional copier Canon i-Sensys MF-463dw	Print Type: Monochrome Supported Print Formats: A4, A5, A6, B5, C5, DL (ISO) Minimum Paper Weight, g/m², from: 60 Maximum Paper Weight, g/m², up to: 120 Maximum Print Resolution, DPI: 1200 x 1200 Maximum Black & White Print Speed, pages/min, up to: 40 Recommended Monthly Load, pages/month, up to: 4000 Scanner Resolution, DPI: 600 x 600 Input Tray Capacity: 50 sheets, 100 sheets, 250 sheets Output Tray Capacity: 150 sheets Features: Automatic Duplex Printing, USB Printing, Apple AirPrint	Purchase of a multifunctional copier for the material and technical base	250000	1	250000	May	50/50%	During the delivery period
AP23488216	Scanner	Scanner	Purchase of a scanner for the material and technical base	75000	1	75000	may	50/50%	During the delivery period

Барлығы: 4 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992870	Ion-plasma nitriding plant BYLXH-30GZD10RB	Auxilixry heating function is available Working temperature <900℃ Effective working dimensions of vacuum furnace - 300 mm×400 mm Ultimate vacuum degree - <6.67 Pa Pressure increase rate - <0. 13pa/min Evacuation time up to 20Pa - <30min Rated load - about 35 kg Standard nitriding area 60000 cm² Power of auxiliary heating 10KW"	To increase the service life and reliability of shut-off and control valve parts, it is necessary to develop ion-plasma nitriding technology. This method improves wear resistance, corrosion resistance and mechanical strength of parts, which is especially important for increasing the reliability and durability of equipment in mechanical engineering and power engineering. The purchase of the installation will allow the implementation of research and industrial tasks of the project, optimize technological processes and reduce costs for importing similar products.	29	1	29	may	50/50%	Delivered
BR24992870	Sormaite powder	Wear-resistant surfacing material used to strengthen and restore parts operating under conditions of increased wear and impact loads. It is a powder mixture based on iron with carbides, alloying elements (e.g. chromium, nickel, molybdenum) and other components that provide high hardness and wear resistance. 200 kg	Sormait is a highly wear-resistant material used to strengthen the working surfaces of parts subject to intense mechanical impact. Its use can significantly increase the service life of equipment and reduce the cost of repair and replacement of worn-out elements. The use of this powder in sprayed coatings will provide additional protection against abrasive wear and corrosion.	200	1	200	may	50/50%	During the delivery period
BR24992870	Gas (nitrogen, hydrogen, oxygen) with cylinder	Nitrogen (N₂) Inert gas, prevents oxidation of metals Hydrogen (H₂) Reducing gas, prevents formation of oxides Oxygen (O₂) Oxidizer, used in oxygen-fuel spraying. Gases in cylinders"	Nitrogen is used in ion-plasma nitriding processes, helping to strengthen metal parts and increase their wear resistance. Hydrogen is used in reduction processes, improving the quality of metal coatings and preventing their oxidation. Oxygen is necessary for high-speed oxygen-fuel spraying, providing high temperature and density of protective layers.	4	1	4	may	50/50%	During the delivery period
BR24992870	Powders (Zr-Y-O, Cr₃C₂-NiCr, NiCr, Ta, WC-Co-Cr, WC-Co, Al₂O₃, Al, Cr₂O₃)	33 kg	The purchase of these powders is necessary for the development and application of protective coatings using high-speed oxygen-fuel spraying and ion-plasma deposition. They provide increased wear resistance, corrosion and thermal resistance of machine-building parts and military equipment. The use of these materials will extend the service life of equipment and improve its performance characteristics.	33	1	33	may	50/50%	Delivered
BR24992870	Low power pump	Type: Submersible Operation Type: Lifting Flow Type: Circulating Power: 35.0 W Max Head (Lift Height): 240.0 cm Dimensions: 106×75×96 mm Weight: 775.0 g	Оборудование необходимо для реализации проекта.	10	1	10	may	100%	Delivered
BR24992870	PVC pipes 100mm	Pipe Material: PVC Pipe Type: Smooth Application Area: Water supply, sewage Outer Diameter: 100.0 mm Pipe Length: 2.0 m Maximum Pressure: PN 6 Wall Thickness: 2.2 mm Color: White	Equipment is necessary to implement the project.	20	1	20	may	100%	Delivered
BR24992870	DTS sensor	Technical Specifications TDS Signal Adapter Board: - Input Voltage: 3.3 ~ 5.5 V - Output Signal: 0 ~ 2.3 V - Operating Current: 3 ~ 6 mA - TDS Measurement Range: 0 ~ 1000 ppm - TDS Accuracy: ±10% F.S. (25°C) - Size: 42 × 32 mm - Module Interface: XH2.54-3P - Electrode Interface: XH2.54-2P TDS Sensor: - Number of Sensors: 2 - Total Length: 83 cm - Connection Interface: XH2.54-2P - Color: White - Other: Waterproof sensor Package Includes: - 1 × TDS Signal Adapter Board - 1 × Waterproof TDS Sensor - 1 × Analog Sensor Cable Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	PH sensor	Amplifier Board: Power Supply Voltage: 5±0.2 V Operating Current: 5–10 mA Operating Temperature: -10…50 °C Service Life: 3 years Dimensions: 42 mm × 32 mm × 20 mm Weight: 25 g pH Sensor: pH Range: 0–14 pH Measured Solution Temperature Range: 0–60 °C Zero Point: 7 ± 0.5 pH Response Time: ≦1 min BNC Connector Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Temperature sensor	Technical Specifications: Type: NTC Thermistor Resistance: 10 kΩ (at 25°C) B-constant: 3380K ±1% Peak Voltage: AC 1800V (1 mA, 2 sec) Dissipation Power: 5 mW/°C Probe Insulation: >100 MΩ Measurement Range: -20…+105°C (accuracy decreases below -20°C) Probe Diameter: 5 mm Probe Length: 25 mm Cable Length: 1 m Casing Material: Stainless Steel Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Water level sensor	Sensor Material: Stainless Steel Cable Length: Approx. 30 cm Float Diameter: 28 mm Float Height: 28 mm Sensor Length (without wires): 100 mm Mounting Thread: M10 Operating Temperature: -30 ℃ ~ +125 ℃ Color: Silver Contact Voltage: AC/DC 100V (max 220V) Compatibility: Arduino, ESP8266, ESP32, Raspberry Pi, W1209	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Arduino Kit	Arduino Mega 2560 R3 Microcontroller: ATmega2560 Clock Speed: 16 MHz Flash Memory: 256 KB SRAM: 8 KB EEPROM: 4 KB Logic Level Voltage: 5 V Input Supply Voltage: 7–12 V Maximum 5V Pin Output Current: 1 A	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Aluminum X-shaped profile	Dimensions: 40×40 mm Slot Width: 10 mm Coating: Anodized layer Weight: Approx. 1.62 kg/m Design: Special cross-section designed to increase resistance to bending and torsion	Equipment is necessary to implement the project.	100	1	100	may	100%	Delivered
BR24992870	100мм Elbow for PVC pipe 100mm	Type: Elbow Pipe Diameter: 100.0 mm Angle: 90.0° Dimensions: 100 Color: White Material: Polypropylene	Equipment is necessary to implement the project.	40	1	40	may	100%	Delivered
BR24992870	Corner for fixing aluminum profile	astener Type Included: Mounting bracket (angle) Purpose: For installation, For aluminum Length: 20 mm Width: 20 mm Material: Aluminum Color: Gray	Equipment is necessary to implement the project.	40	1	40	may	100%	Delivered
BR24992870	PVC coupling 100mm	Equipment is necessary to implement the project.	Type: Coupling Pipe Diameter: 100.0 mm Dimensions: 100 Material: Polypropylene	20	1	20	may	100%	Delivered
BR24992870	Cable	Type of Cable Product: Cable Cable Type: Household, Power Marking: PVS Number of Cores: 2 Cross-Section: 2.5 mm² Length: 1.0 m Conductor Material: Copper Application: Indoor, Outdoor Sheath Material: PVC compound Insulation Material: PVC	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Container 30l	Type: Container Shape: Rectangular Material: Plastic Lid: Included Handles: Included Width: 390 mm Length: 620 mm Height: 190 mm Volume: 30 L	Equipment is necessary to implement the project.	30	1	30	may	100%	Delivered
BR24992870	Seedling cups	Type: Pot Purpose: For seedlings Material: Plastic Shape: Round Color: Black Drainage Holes: Yes Size: 45×55 mm	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	power unit	Compatibility: For video surveillance, LED strips, power supply Device Type: Power supply unit Voltage: 12V Dimensions: 19 x 9 x 4 cm Operating Temperature: -10°C ~ +60°C	Equipment is necessary to implement the project.	100	1	100	may	100%	Delivered
BR24992870	Tube 8 mm	Net Weight: 0.583 kg Tube Diameter: 8 mm Hose Length: 25 m Tube Material: PVC	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Bolts nuts	Type: Bolt Length: 35 mm Diameter: 6 mm Set Includes: Bolt, nut, washer	Equipment is necessary to implement the project.	20	1	20	may	100%	Delivered
BR24992870	Ultraviolet lamp	Base Type: No base Lamp Type: Ultraviolet Number of Light Sources: 96 Power of Light Source: 100 W Luminous Flux: 16,000 lm Color Temperature: 16,000 K Mounting Type: Pendant Material: Aluminum Dimensions: 12 x 23 cm Color: Black	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Extension cord	USB Port: Yes Light Indicator: Yes Cable Length: 2.0 m Dimensions (W×H×D): 170 × 100 mm Built-in Charging Ports for Phones and Gadgets: 4× USB, 2× Type-C Type: Power strip Number of Sockets: 3 Socket Type: Type C (Euro standard with grounding) Input Voltage: 220.0 V Rated Current: 10.0 A Color: Black	Equipment is necessary to implement the project.	10	1	10	may	100%	Delivered
BR24992870	Automatic screwdriver	Impact Function: No Functions: Reverse, Drilling Package Includes: Case Battery Voltage: 20.0 V Battery Type: Li-Ion Battery Capacity: 2.0 Ah Battery Charging Time: 1.0 hour Power Supply: Battery-powered Battery and Charger Included: Yes Chuck Type: Keyless Tool Type: Drill-driver Number of Speeds: 2 Chuck Diameter: 10 mm Max No-load Speed: 1400 rpm Max Torque: 45.0 Nm	Equipment is necessary to implement the project.	2	1	2	may	100%	Delivered
BR24992870	Soldering iron	Material (Handle): Plastic Dimensions: 26×15×5 cm Set Includes: Soldering iron; 5 tips; rosin; stand; desoldering pump; sponge; solder wire; wire stripper; 2 jumper wires; 2 tweezers; 6 hooks; screwdriver with 5 bits Additional Info: Comes in a carrying bag Type: Soldering Iron Power: 60.0 W Power Adjustment: Smooth (stepless) Power Supply: AC mains Input Voltage: 220 V Soldering Station Features: Adjustable temperature Model/Item Code: SIK008 (26 items) Heater Type: Ceramic Min. Heating Temperature: 200.0 °C Max. Heating Temperature: 450.0 °C Temperature Stabilization: Yes Tip Material: Copper with coating	Equipment is necessary to implement the project.	2	1	2	may	100%	Delivered
BR24992870	Roller pipe cutter 100 mm	Pipe Cutter Type: Roller Type: Pipe Cutter Compatible Pipe Types: Metal-plastic, PVC, HDPE, polypropylene, PEX, CPVC Drive Type: Manual Max Diameter: 110.0 mm Power Supply: None (manual operation)	Equipment is necessary to implement the project.	2	1	2	may	100%	Delivered
BR24992870	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	400000	2	800000	may	50/50%	Delivered
BR24992870	Laptop	Screen Diagonal screen: 16.0 inches Screen resolution: 2560x1600 2.5K Screen refresh rate: 240 Hz Screen brightness: 500.0 cd/m2 Screen coating: matte Touch screen: no Matrix type: IPS Processor Maximum processor frequency: 4900.0 MHz Processor: Intel Core i7-13650HX Base frequency of the processor: 2600.0 MHz Number of processor cores: 14 cores Cache size: L324 MB memory RAM size: 16.0 Gb Memory type: DDR5 Memory frequency: 4800.0 MHz Maximum memory size: 32.0 Gb Number of memory slots: 2 Storage device Hard disk type: SSD Total storage volume: 1000.0 Gb Storage interface: SSD Video Type of video adapter: discrete and integrated video card Video card: NVIDIA GeForce RTX 4060 + Intel UHD Graphics Video memory type: GDDR6 Video memory size: 8192.0 Mb Wireless communication and connection Standard Wi-Fi 802.11ax Bluetooth version: 5.3 Network card built-in network card, 1000 Mbit/c Number of interfaces USB 3.12 Interface: Thunderbolt 4, USB 3.2 Gen1 Type-A, USB 3.2 Gen2 Type-C Input: microphone/headphone combo Outputs: HDMI, RJ-45 Sound and input devices: Sound 2 speakers with the technology of intelligent amplification Smart AMP Positioning devices: NumberPad Backlit keyboard: Yes Keyboard layout: Russian, English Features and additional information Camera Resolution: 720p HD Additional information Technology NVIDIA Advanced Optimus Display ROG Nebula Response time 3 ms Color gamut DCI-P3 100% Support for technologies Dolby Vision HDR and Dolby Atmos 2 dynamics with technology of intelligent amplification Smart AMP Certification Hi-Res Technology of intellectual noise reduction Nutrition Battery: 80-90 Wh Weight 2.6 kg	Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop.	1200000	1	1200000	August-October	50/50	During the delivery period
BR24992870	Laptop	Display Screen Size: 14.0 inches Resolution: 1920 x 1200 WUXGA Refresh Rate: 60 Hz Screen Brightness: 400.0 cd/m² Screen Coating: Glossy Display Type: OLED Processor Maximum Processor Frequency: 4500.0 MHz Processor: Intel Core Ultra 5 125H Base Processor Frequency: 1200.0 MHz Number of Processor Cores: 14 Cores Cache Size: L318 MB Memory RAM Size: 16.0 GB Memory Type: LPDDR5X Memory Frequency: 7467.0 MHz Storage Devices Hard Drive Type: SSD Total Storage Capacity: 512.0 GB Flash Card Reader: Yes Video Video Adapter Type: Integrated graphics Graphics: Intel Arc Graphics Wireless and Connectivity Standard: Wi-Fi 802.11ax Bluetooth Version: 5.2 Number of Interfaces: USB 3.02 Interfaces: USB Type-C Sound: Front-facing speakers: 2 W x 2 Keyboard Backlight: Yes Keyboard Layout: Russian, English Features and Additional Information Camera: Infrared camera, physical shutter on the camera, 1080p FHD resolution Power Battery: Up to 57 Wh Weight and Dimensions	Successful implementation of the project requires modern computer equipment that ensures the execution of computational, analytical and design tasks. The project includes types of work directly related to the need to use a high-performance laptop.	690000	1	690000	August-October	50/50	During the delivery period
BR24992870	Cold rolled sheet 3x1250x2500 mm 12X18N10T GOST 5582-75 GOST 19904-90 (2р), Circle Ø25 12Х18Н10Т L= 2-6m GOST 5949 2018 GOST 2590 (20р)	Product type: Cold rolled sheet (CR) Dimensions: thickness – 3 mm, width – 1250 mm, length – 2500 mm Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5582-75 (for steel), 19904-90 (for sheet metal) Surface condition: cold rolled, polished/uncoate Material density: ~7.9 g/cm³ Weight of 1 sheet: ~74 kg (estimated: 3 mm × 1.25 m × 2.5 m × 7.9 t/m³) Product type: round rolled products (circle) Diameter: Ø25mm Length: 2–6m Steel grade: 12Х18Н10Т (stainless, corrosion-resistant, austenitic class) GOST: 5949‑2018 (for stainless steel), 2590 (for hot-rolled products) Condition: hot-rolled or calibrated	Cold-rolled sheet 3×1250×2500mm made of 12X18N10T steel will be used to manufacture experimental samples and parts as part of the project. The material is necessary for conducting a series of studies on the application and testing of coatings, since its characteristics will ensure the correctness and reproducibility of the experimental results. The Ø25mm circle made of 12X18N10T steel will be used to manufacture experimental blanks and parts required for conducting research within the framework of the project. The material will provide stable mechanical and corrosion properties, which will allow obtaining correct and reproducible test results.	859874	1	859874	August-October	50/50	During the delivery period
BR24992870	Рowders for plasma surfacing	Stellite 12 Powder (Co-30Cr-8W-3Ni-2Fe-1.4C-1-2%Si-<1%Mn, 53-150 μm) 2x69 750=139 500 Stellite 21 Powder (27Cr–5.5Mo–2.8Ni–1.5Fe–1Si–0.25C, 53-150 μm) 2x69 750=139 500 Stellite 190 Powder (30Cr–12.5W–1.1Si–1.4C, 53-150 μm) 2x61 875=123 750 Deloro 56 Powder (<0.6C–17Cr–2.5Mo–4.5Si–3.6B–3Fe–2.5Cu, 53-150 μm) 2x70 000= 140 000 Deloro 60 powder (~0.7C–15Cr–4.4Si–3.1B–<4Fe, 53-150 μm) 2x70 000= 140 000 PS-12NVK-01 Powder 65% PG-10N-01 + 35% WC, 53-150 μm 2x75 000= 150 000 PR-7Kh5M4FGBR powder 53-150 μm 2x65 000= 130 000 High carbon, high chromium iron powder based powder (C 3.9%, Cr 26%, Si 1.5%, Ni 1.7%, W 0.3%, Mo 0.1%, Mn 1.1%, 53-150 μm) 2x60 000=120 000 Powder WC-20Ni (Tungsten carbide with nickel powder) (WC ~80%, Ni ~20%, 53-150 μm) 2x88 875= 177 750 Powder Co-Cr-W-Ni-Fe alloy powder (Co-Cr-W-Ni-Fe alloy powder, 53-150 μm) 2x101 250 = 202 500 Powder Ni-B-Si-Fe alloy with added tungsten carbides (Ni-B-Si-Fe alloy with added tungsten carbides, 53-150 μm) 2x72 000= 144 000	The powders specified will be used for plasma surfacing work within the framework of the project plan. Their chemical composition and dispersion will ensure the production of coatings with various physical, mechanical and corrosion-resistant properties, which is necessary for comparative studies and the selection of optimal application modes.	1610000	1	1610000	August-October	50/50	During the delivery period
BR24992870	Diamond cutting disc 110201.0 mm, Metal cutting band saw 164138/12	for cutting hard materials 5x32 000=160 000, bi-metal, tooth pitch 8/12TPI 5x25 000=125 000	Their availability is necessary for sample preparation and assembly, surfacing, automatic and manual welding, and subsequent mechanical processing. The purchase of these consumables and equipment will ensure the smooth execution of technological operations and compliance with the project implementation deadlines.	285000	1	285000	August-October	50/50	During the delivery period
BR24992870	Ammonia anhydrous liquefied with a reducer	Ammonia grade A, 40 l, reducer model: BAMO-1.21 (version 09) TU 26-05-25-84	A supply of process ammonia (NH₃) in cylinders is required, along with a two-stage pressure reducer (pressure regulator) and a safety kit to ensure stable, reproducible and safe operation of the ion-plasma nitriding (IPN) unit.	1325000	1	1325000	August-October	50/50	During the delivery period
BR24992870	Laboratory and technological equipment, consumables and components	9.1-inch 4K monochrome LCD display - 1 pc (143,000) CCT-3320T conductivity monitor with CON-1134-13 conductivity sensor - 1 pc (33,600) MARK-902/1 pH meter - 1 pc (1,147,200) GP-902/1 Hydraulic panel for the MARK 902 BP31.07.000-01 device - 1 pc (345,000) BP31.02.700 flow-through cuvette - 1 pc (212,000) Single-channel compressor - 1 pc (5,800) 8x3.5 cm air pump - 1 pc (9,500) M5 carbon steel T-nuts, 3030, 50 pcs/pack - 3 pack (24,600) 3030-6 Aluminum Corner Brackets, 10 pcs/pack - 3 packs (20,700) 3030 Aluminum Profile, 1200 mm, 6 pcs/pack - 1 pack (24,500) 3030 Aluminum Profile, 900 mm, 20 pcs/pack - 1 pack (61,800) FD-100 Electric Exhaust Fan - 1 pc (25,900) T.XA-420-Kl1-1-8 Temperature Sensor 300-(0/+300°C) - 1 pc (65,500) DN-300 Vikhr Drainage Pump - 2 pcs (50,000) Dielectric Mat, 750*750 mm - 1 pc (6 800)	A set of equipment, instruments and consumables is necessary for equipping and modernizing the experimental installation, which is used in the framework of studies on the development and optimization of technological processes of surface treatment by ion-plasma and electrochemical methods. Ensuring the possibility of conducting accurate, reproducible experiments related to the control of physical and chemical parameters of the environment, as well as stable operation of auxiliary systems of the installation (gas, liquid, ventilation and measuring).	2176300	1	2176300	August-October	50/50	During the delivery period
BR24992870	A service for conducting research on the elemental-phase composition and tribological properties of samples	Determination of the elemental phase composition of coatings (number of samples: 50). The elemental composition of the coatings was determined using energy-dispersive X-ray spectroscopy (EDS) on a scanning electron microscope (SEM) in secondary (SE) and backscattered electron (BSE) modes. For each sample, the elemental distribution across the cross-section was analyzed using linear analysis and elemental mapping covering the coating/substrate interface. Micrographs of the cross-section were also obtained at various magnifications (at least 3 magnified images). Result: SEM images, EDS spectra, and quantitative analysis of the elemental content. The phase composition was determined by X-ray diffractometry. Shooting modes: diffraction angle 20-90 degrees; shooting step 0.02 degrees; exposure time 0.5 seconds. Result: diffraction pattern without decoding and data in electronic format with a .txt file extension. 2.2 Study of the tribological properties of the coatings (number of specimens: 50). Tribological tests shall be carried out using the ball-on-disc method in accordance with ASTM G99. Test parameters: counterbody - steel ball; ball diameter 3-6 mm; load not less than 5 N; rotation speed not less than 0.02 m/s; track radius not less than 2 mm; track length not less than 60 m. Tests shall be carried out in dry friction mode at room temperature. After the ball-on-disc friction test, determine the wear rate and area using profilometry in accordance with ISO 13565. Result: graphs of the friction coefficient versus friction distance in PDF format, wear rate and area, as well as these graphs of the friction coefficient versus friction distance in electronic format (file extension txt). Test specimens for abrasive wear in accordance with GOST 23.208-79 "Unified Testing System." Method for Determining Abrasive Wear. Tests must be conducted using appropriate equipment under controlled conditions, with all parameters influencing the results (load, type of abrasive, sample weight before and after testing, etc.) recorded. Result: a brief description of the test methodology and presentation of the obtained data in tabular form.	Conducting a comprehensive study of the elemental-phase composition and tribological properties of coatings on the surface of stainless steels and heat-resistant nickel alloys obtained by plasma surfacing and thermal spraying, as well as samples after treatment by ion-plasma nitriding.	3900000	1	3900000	August-October	50/50	During the delivery period
BR24992870	Welding materials, equipment and tools for welding and grinding works	MP-3 ARS Electrodes, 3mm Diameter, 2.5kg Pack (5kg) - 9,400 MP-3 ARS Electrodes, 5mm Diameter, 5kg Pack (10kg) - 18,600 309LSI Stainless Steel Wire, 1.2mm Diameter (5kg) - 41,000 LC1230N Metal Cutting Saw (1pc) - 397,060 SV-08G2S Welding Wire, 1.2mm Diameter (18 pcs) - 26,406 AG-125 SGM Angle Grinder (1pc) - 22,230 AIR-25 Compressor (24L, 206L/min input, 1.5 kW, 220V)/Aurora (1pc) - 88,350 Welding mask "Chameleon" A777c (9-13DIN) KAZAKHSTAN (3 pcs) - 26,300 Aluminum wire ER5356, 1.2 mm dia. (5 kg) - 30,000 Electrode holder DE 2300 (512.D070) (1 pc) - 12,950 Welding hammer with spring handle (1 pc) - 1,700 Cutting wheel 125 x 1.6 x 22 mm A646R (340946) (10 pcs) - 8,250 Cutting wheel 150 x 1.6 x 22 mm A46TZ Special (241472) (10 pcs) - 12,000 3M™ reusable half mask, size M, model 6200 (3 pcs) - 23,700	The procurement of a complete welding equipment set, materials, and accessories is necessary for welding, cutting, and grinding operations during the fabrication, assembly, and repair of experimental prototypes, as well as for the preparation and processing of metal structures for experimental research and process debugging. This ensures the ability to perform high-quality and safe welding and metalworking operations during the preparation of parts and assemblies used in experimental and production work.	775000	1	775000	August-October	50/50	During the delivery period
BR24992870	Stegler HS-Pro Digital Stirrer (HS-Pro Digital Magnetic Stirrer with Heating)	The Stegler HS-Pro Digital Magnetic Stirrer with Heating is a modern laboratory instrument designed for the simultaneous stirring and heating of liquid media. It features digital controls and an LCD display showing the actual and set temperature and speed values. The speed range is 200–1500 rpm, allowing the stirrer to be used with solutions of varying viscosities. The maximum stirred volume is 20 liters (for water). The heating temperature is adjustable up to 380°C, ensuring reactions requiring high temperatures. The working surface is made of aluminum with a 150×150 mm ceramic coating that is chemically resistant and distributes heat evenly. The heater output is approximately 500 W, and the power supply is 220 V, 50 Hz. The device features overheating protection (automatic shutdown at temperatures above 400°C) and a hot surface indicator. The dimensions of the mixer are approximately 170×320×105 mm, weight is about 2.7 kg.	The Stegler HS-Pro Digital combines high heating power, a wide speed range, and convenient digital control, making it ideal for laboratory work involving solution preparation, chemical syntheses, and temperature-sensitive reactions. The ceramic work surface is resistant to aggressive reagents, ensures uniform heating, and a safety system enhances operational safety. Precise temperature and speed control ensure consistent parameters, which is especially important for reproducible experimental studies.	135000	1	135000		50/50	During the delivery period

Барлығы: 37 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22683114	Potato	Reproduction: Elite and/or first reproduction Diameter: 40–50 mm Net weight: 6t	For experiments	2	1	2	april	100%	Delivered
AP22683114	Fertilizer	Fertilizer	For experiments	479	1	479	april	100%	During the delivery period

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP19178510	Monoblock PC	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	400000	1	400000	September	50/50%	During the delivery period

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP19175164	Scientific research service	Publishing monographs	The publication of monographs is an important tool for disseminating, consolidating and developing scientific knowledge obtained within the framework of the project	2300	100	230000	november	50/50%	During the delivery period
AP19175164	Monoblock Acer Aspire C24-2G	Processor: Intel Core i5-13420H RAM: 16 GB DDR4 3200 MHz Storage: 512 GB M.2 NVMe SSD Display: 23.8" Full HD (1920×1080), IPS Networking: WiFi 6 and Bluetooth 5.0 Included: wireless keyboard and mouse Operating System: Windows 11 Color: Black	Purchase of a monoblock for the material and technical base.	425300	2	850600	april	50/50%	Delivered
AP19175164	Scientific research service	Purchase of stationery	for the implementation of the project and the preparation of the final report	53010	1	53010		100%	During the delivery period

Барлығы: 3 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
AP22684076	Laboratory centrifuge	Laboratory centrifuge	Research within the project	803	1	803	may	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software	Whey protein concentrate – 2 pieces	To provide an experiment.	40	1	40	April	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software	Cold pressed cedar oil (Katon-Karagay) - 0.5 l	To provide an experiment.	30	1	30	April	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software	Supergel 1000 (Carrageenan) - 2 pcs.	To provide an experiment.	20	1	20	april	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software"	Beef 1 category - 30 kg	To provide an experiment.	90	1	90	april	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software"	Horse meat, 1st grade – 30 kg"	To provide an experiment.	105	1	105	april	100%	During the delivery period
AP22684076	Procurement of materials, equipment, and/or software	50 ml volumetric flask – 6 pieces"	To provide an experiment.	12	1	12	april	100%	Delivered
AP22684076	Procurement of materials, equipment, and/or software	Artificial sausage casing – 4 pieces	To provide an experiment.	10	1	10	April	100%	Delivered
AP22684076	Procurement of materials, equipment, and/or software	Spice and seasoning mix – 3 pieces	To provide an experiment.	8	1	8	April	100%	Delivered
AP22684076	Scientific research service	Laboratory services for determination of fatty acid composition	To provide an experiment.	20000	3	60000		100%	During the delivery period

Барлығы: 10 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР22688434	Scientific research service	Memories of Alash (working title)	Research within the project	1	1	1	may	100%	During the delivery period

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22686900	Biological microscope with camera	Biological microscope with camera	Equipment is necessary to implement the project.	1386841	1	1386841	may	100%	During the delivery period

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22686708	Scientific research service	Publishing monographs	The publication of monographs is an important tool for disseminating, consolidating and developing scientific knowledge obtained within the framework of the project."	2250	100	225000	june	100%	During the delivery period
AP22686708	Scientific research service	Laboratory services for determination of organoleptic indicators, heavy metals, minerals	Research within the project	134682	1	134682	may	100%	During the delivery period

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
AP22685400	Scientific research service	Service for the development and manufacture of a prototype device "Endoviovaginoscope for cows and sheep"	The service is necessary to complete the project.	1300000	1	1300000	april	100%	Delivered

Барлығы: 1 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24992940	"Whole Genome Sequencing of Sheep Progeny Obtained by Interbreeding"	Whole genome sequencing of sheep progeny obtained by interbreeding 97 sheep	In pursuance of the calendar plan items	19	1	19		50/50%	Delivered
BR24992940	Bioinformatics analysis of molecular genetic research data	Bioinformatics analysis of molecular genetic research data	In pursuance of the research plan items	5	1	5		50/50%	Delivered
BR24992940	PureLink™ Genomic DNA Isolation Kit, 250 isolates (K182002)	PureLink™ Genomic DNA Isolation Kit, 250 isolates (K182002)	DNA Isolation Kit	713384	1	713384		50/50%	Delivered
BR24992940	1.5 ml low adhesive tubes 250 pcs/pack (90410)	5 packs 1.5 ml low adhesive tubes 250 pcs/pack	5 packs 1.5 ml low adhesive tubes 250 pcs/pack	126435	1	126435		50/50%	Delivered
BR24992940	2-Propanol EMPLURA®			79800	1	79800		50/50%	Delivered
BR24992940	Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China)	Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China) 5 packs	Tips 10 µl, in a rack, free of DNA/RNA, sterile (pack = 96 pcs) (China) 5 packs	13775	1	13775		50/50%	Delivered
BR24992940	Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs)	Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs) 5 packs	Tips 2-200 µl universal in an autoclavable stand (sterile) (Italy) (pack = 96 pcs) 5 packs	27360	1	27360		50/50%	Delivered
BR24992940	Tips 1000mkl universal (sterile) (pack=1000pcs) (China	Tips 1000mkl universal (sterile) (pack=1000pcs) (China 5 packs	Tips 1000mkl universal (sterile) (pack=1000pcs) (China 5 packs	12825	1	12825		50/50%	Delivered
BR24992940	Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs)	Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs) 5 packs	Microtubes 1.5 ml type Eppendorf (China) (pack = 500 pcs) 5 packs	9100	1	9100		50/50%	Delivered
BR24992940	Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;)	10 pieces Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;)	10 pieces Medical waste bag class B (yellow. 50 cm * 80 cm * 16 microns;)	20000	1	20000		50/50%	Delivered
BR24992940	Parafilm	Parafilm (Paraﬃn Sealing Film) (100 mm*38000mm. Material: primarily composed of polyolefins and paraffin waxes offering good resistance against acids, alkalis and some organic solvents;62-0010;Biologix;Пленка парафилм, размеры 100 мм х 38 м. Рекомендуемая температура:-80~90 С. Максимальная длина растяжения: эластичность (25°C):400%. Материал: в основном состоит из полиолефинов и парафиновых восков, обеспечивающих хорошую устойчивость к кислотам, щелочам и некоторым органическим растворителям) - 5 pieces	Parafilm (Paraﬃn Sealing Film) (100 mm*38000mm. Material: primarily composed of polyolefins and paraffin waxes offering good resistance against acids, alkalis and some organic solvents;62-0010;Biologix;Пленка парафилм, размеры 100 мм х 38 м. Рекомендуемая температура:-80~90 С. Максимальная длина растяжения: эластичность (25°C):400%. Материал: в основном состоит из полиолефинов и парафиновых восков, обеспечивающих хорошую устойчивость к кислотам, щелочам и некоторым органическим растворителям)	166500	1	166500		50/50%	Delivered
BR24992940	Polyethylene Bags	Polyethylene Bags (Полиэтиленовые пакеты, идеально подходят для хранения образцов, 1000 шт/уп) (4 x 6 inch, Thickness: 4 mil, Case of 1000 (10.16х15,24 см). Идеально подходят для образцов, требующих постоянной герметичности, особенно если образцы будут храниться в течение длительного периода времени;EF28271E (28-6-618);Daigger) 10 packs	Polyethylene Bags (Полиэтиленовые пакеты, идеально подходят для хранения образцов, 1000 шт/уп) (4 x 6 inch, Thickness: 4 mil, Case of 1000 (10.16х15,24 см). Идеально подходят для образцов, требующих постоянной герметичности, особенно если образцы будут храниться в течение длительного периода времени;EF28271E (28-6-618);Daigger)	20000	1	20000		50/50%	Delivered
BR24992940	Центрифужные пробирки, амбер (темный цвет), с закручивающейся крышкой, ПП, объем 50 мл, 30 x 120 мм, нестерильные, плоское дно	Centrifuge tubes - screw cap - P.P - 15 ml - produced in ASEPTIC (sterile) conditions “Sterile A” (Центрифужные пробирки, амбер (темный цвет), с закручивающейся крышкой, ПП, объем 50 мл, 30 x 120 мм, нестерильные, плоское дно, 20 штук в упаковке;078.12.005;Isolab, Германия) 10 packs	Centrifuge tubes - screw cap - P.P - 15 ml - produced in ASEPTIC (sterile) conditions “Sterile A”	30000	1	30000		50/50%	Delivered
BR24992940	50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C.	50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C. 10 packs	50 ml Self Standing Centrifuge Tube with flat cap (25 Tubes/pk. Free from Dnase/ Rnase/ Endotoxin, Withstands temperatures from -80° to +121° C.	50000	1	50000		50/50%	Delivered
BR24992940	Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000	Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000	Disodium EDTA Dihydrate 99+% for Analysis, 100g, ACRO147851000	40768	1	40768		50/50%	Delivered
BR24992940	CTAB ≥99 %, 100 g, Roth Carl, 9161.1"	CTAB ≥99 %, 100 g, Roth Carl, 9161.1"	CTAB ≥99 %, 100 g, Roth Carl, 9161.1"	32368	1	32368		50/50%	Delivered
BR24992940	"Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262"	"Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262"	"Натрий хлорид 99,5-100,5%, AnalaR NORMAPUR® ACS, Reag. Ph. Eur. аналитический реагент, 500 г, VWR Chemicals, 27810.262"	32928	1	32928		50/50%	Delivered
BR24992940	0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799	0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799	0,5 M Tris-HCl, pH 6,8 (1 л), Bio-Rad, 1610799	64878	1	64878		50/50%	Delivered
BR24992940	Deionized water, 500 ml, Hach, HACH27249	Deionized water, 500 ml, Hach, HACH27249	Deionized water, 500 ml, Hach, HACH27249	26320	1	26320		50/50%	Delivered
BR24992940	2-mercaptoethanol 99%, pure, 250 ml, Thermo Scientific, ACRO125472500	2-mercaptoethanol 98-99%, pure, 250 ml, Thermo Scientific, ACRO125472500	2-mercaptoethanol 99%, pure, 250 ml, Thermo Scientific, ACRO125472500	44480	1	44480		50/50%	Delivered
BR24992940	"Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290"	"Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290"	"Sodium hydroxide solution 10%, AnalaR NORMAPUR®, 1 l, VWR Chemicals, 85660.290"	47040	1	47040		50/50%	Delivered
BR24992940	Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500	Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500	Lysis buffer CTAB, 500ml, PanReac AppliChem, A4150.0500	36288	1	36288		50/50%	Delivered
BR24992940	Laptop	Laptop Apple MacBook Pro 16 MK183 512Gb Space Gray 16.2" 3456 x 2234, IPS, 120 Hz, Apple M1 Pro (10 cores), 16 Gb, SSD 512 Gb, integrated video card, Mac OS, cover color gray, battery 100 Wh	4 Laptop Laptop Apple MacBook Pro 16 MK183 512Gb Space Gray 16.2" 3456 x 2234, IPS, 120 Hz, Apple M1 Pro (10 cores), 16 Gb, SSD 512 Gb, integrated video card, Mac OS, cover color gray, battery 100 Wh To fill in the research data in the IFA and IAS. Storing data in digital form helps to create a database for each animal, which simplifies the accounting and analysis of breeding work 852 501 March-April 50/50 Burambaeva N 87058312315	803935	1	803935	Наурыз-сәуір	50/50%	During the delivery period
BR24992940	Sheep handling crate	Sheep handling crate with built-in scales and animal recognition sensors by RFID chip	To carry out animal grading, determining live weight at different periods of growth and development of sheep	2700000	1	2700000		50/50%	Delivered
BR24992940	Portable animal sperm analyzer with iPad	iSperm mCASA – a mobile computer-assisted sperm analysis system (mCASA)	For fast and accurate assessment of ram semen quality	3000000	1	3000000	Наурыз-сәуір	50/50%	Delivered
BR24992940	Animal feed – Hay	Color - from green to yellow-green or green-brown. Appearance - no signs of moldiness, no moldy layers. Smell - no signs of musty, moldy, putrid or other foreign odors. Content of harmful and poisonous plants no more than 1%. The presence of foreign impurities, including clods of earth, stones, fuels and lubricants - is not allowed. Consistency - non-smearing, without sliminess. Content of crude protein, g / kg dry matter (DM), not less than: 120-90. Content of crude fiber, g / kg dry matter, not more than: 290-320. Content of acid-detergent fiber, g / kg dry matter, not more than: 380-430. Neutral detergent fiber content, g/kg dry matter, no more than: 650-720. Crude ash content, g/kg dry matter, no more than 100-90. Dry matter content, g/kg, no less than 830. Metabolic energy content*, MJ/kg DM, no less than: 8.9-7.9. Delivery of goods in bales, no less than 20 kg in one bale. Quantity of goods purchased = 5 tons	for animal feeding	0	1	0	may	100%	During the delivery period
BR24992940	Animal feed – Oats	Color – white, yellow, large cylindrical or pear-shaped grain. Content of grains of another type or subtype no more than 10%. in a healthy, unheated state. Smell without mold, malt, musty and other foreign odors. Humidity no more than 13.5%. Natural weight no less than 550-520 g/dm. Kernel no less than 65-63%. Weed impurity no more than: including: mineral impurity 0.2%; pebbles 0.1%; wild oats 2.0%; cockle 0.2%. Grain impurity no more than: including: oat grains classified as grain impurity 3.0%; sprouted 2.0%; grains and seeds of other cultivated plants (barley, rye) 1.0%. Small grains no more than 3.0%. Acidity (degrees) no more than 6.0-8.0. The content of toxic elements (benzapyrene, pesticides, radionuclides, harmful impurities, genetically modified organisms, pest infestation and contamination with dead insect pests in oat grain should not exceed the permissible levels established by regulatory legal acts in force in the territory of the Republic). The quantity of goods purchased = 3 tons"	for animal feeding"	0	1	0	may	100%	During the delivery period
BR24992940	Laptop Apple MacBook Air A3114	Processor Apple M1 Pro (10-core) Graphics Apple M1 Pro (16-core GPU) RAM 16 GB Unified Memory SSD 512 GB Display 16.2", Liquid Retina XDR, 3456×2234, 120 Hz, up to 1600 nits Ports 3× Thunderbolt 4, HDMI, SDXC, MagSafe 3, 3.5 mm Battery 100 Wh, up to 21 hours of video playback, fast charging Camera/Audio 1080p FaceTime, 6-speaker system Dimensions/Weight ~35.6×24.8×1.68 cm / ~2.15 kg Color Space Gray	The device, with high performance and energy efficiency, ensures stable operation with resource-intensive professional software, which is essential for the effective completion of project and research tasks.	901968	2	1803936	-	50/50%	During the delivery period

Барлығы: 28 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23488960	Rotary evaporator RE100-Pro.	Specifications: -Large, easy-to-read digital LCD screen displaying heating temperature, rotation speed, and synchronization. -Speed range: 20 to 280 rpm. -Large 5L water-oil heating bath with a temperature range from ambient temperature to 180°C. -Heating bath with precise temperature control and an adjustable safety circuit. -Removable control panel for remote operation. -Patented condenser (cooling surface of 1500 cm²) with excellent cooling efficiency. -Motorized lift with fast automatic release of the evaporating flask to the upper position in case of power failure. -Adjustable end position recognition for protecting the operator and sample from breakage. -Evaporating flask with an ejector, making it easy to remove. -Available with a timer function for precise process control. -Chemically resistant dual PTFE system and patented spring-loaded seal ensure excellent sealing. -PC connectivity via USB for monitoring and documentation of all parameters. Technical Specifications: -External dimensions (L × W × H): 457 × 465 × 583 mm -Net weight: 15 kg -Interface: RS 232 -Power supply: 110/220 V, 50/60 Hz -Gross weight: 40 kg -Packaging dimensions: 110 × 60 × 65 mm	For evaporation of liquid after extraction of plants and mud or one of its fractional components at reduced pressure.	1	1	1		50/50%	Delivered
АР23488960	Freeze dryer Scientz-12N .	Country of Manufacture: China Technical Specifications: -Idle temperature: <-56°C -Freezing area: 0.12 m² -Plate capacity: 1.5 L -Water trapping capacity: 4 kg -Vacuum level: <10 Pa -Sample tray size: 4 × Φ200 mm -Power consumption: 1500 W -Power supply: 220 V / 50 Hz -Layer spacing: 70 mm -Cold trap size: Ø250 × 150 mm -Schering bottle capacity: Ø22:260 Ø16:480 Ø12: 920	To remove moisture from substances using the sublimation method, which ensures the evaporation of water from ice without entering a liquid state.	2	1	2		50/50%	Delivered

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR24993178	Reactor with mechanical stirring MSG1000-P3-T3-HC1-SV-R Country of origin: China This product includes a mechanical stirrer, a heating furnace, and an intelligent temperature controller. A 7-inch high-definition touchscreen is provided for temperature c	Country of origin: China This product includes a mechanical stirrer, a heating furnace, and an intelligent temperature controller. A 7-inch high-definition touchscreen is provided for temperature control and rotation speed adjustment. Equipped with a USB interface, changes in temperature, rotation speed, and other reaction process parameters are recorded in real-time and can be downloaded via a USB flash drive. Model: MSG1000-P3-T3-HC1-SV-R Nominal volume: 1000 ml Maximum operating temperature: 300 ℃ Design pressure: 10.3 MPa Heating mode: built-in stainless steel heating module Heating power: 1 kW Stirring speed: 400–1400 rpm (stepless speed adjustment) Stirring method: mechanical stirring	Development of technology for producing high-quality bitumen from by-products of oil production and refining, which allows improving the quality of bitumen	8	1	8		50/50%	Delivered
BR24993178	Galvanic Bath GFD-23	Bath volume: 10 liters Country of origin: China	For conducting comprehensive experimental studies on the extraction of non-ferrous, precious and rare earth metals from lead production slags	7	1	7		50/50%	Delivered
BR24993178	Penetrometer SYD-2801E1	I. General Description 1. The use of a high-precision temperature controller ensures convenient temperature adjustment and high accuracy of temperature control. 2. Equipped with a cold light source and magnifying glass, making it easy to operate and use. 3. Features a penetration display; the data is stable and accurate, and easy to observe. 4. Equipped with a coarse and fine adjustment function of the lifting frame, allowing easy alignment of the needle tip with the sample surface. II. Main Technical Specifications 1. Power supply: AC (220±10%) V, 50 Hz; 2. Measurement range: 0 to 600 penetrations; 3. Resolution: 0.1 penetration (0.01 mm); 4. Time settings: 5 s, 8 s, 10 s, 12 s, 30 s, 60 s, with an accuracy of less than ± 0.1 s; 5. Power consumption: 200 W; 6. Temperature control accuracy: 25 ℃ ± 0.1 ℃; 7. Constant temperature bath: chamber made of solid glass; 8. Stirring: magnetic stirrer, rotary stirring; 9. Operating environment: Temperature (15–35) ℃; Relative humidity ≤85%; 10. Dimensions: 260 mm × 400 mm × 640 mm (L × W × H); 11. Net weight: 16 kg.	to determine the penetration of petroleum bitumen by automatically measuring the depth of immersion in a test sample of a standard needle in weight, shape and size at a set temperature for a set time.	1	1	1		50/50%	Delivered
BR24993178	Flotation Machine FML 12 (247 FL)	Useful chamber capacity, L – 12. Impeller diameter, mm – 100. Impeller rotation frequency, s⁻¹ – 15-30. Air volume sucked in by the impeller at maximum rotation frequency, L/s, not less than – 0,27. Foam scraper rotation frequency, rpm – 14. Drive power, kW - 0,25	For the beneficiation of ore, other minerals, and industrial waste, as well as for the separation of relatively fine solid particles suspended in a liquid (or their extraction from the liquid) based on their ability to adhere to gas bubbles, oil droplets, etc., introduced into the suspension, in order to extract the valuable component.	3	1	3	may	50/50%	Delivered
BR24993178	Muffle furnace cabinet.	655х875х835	For ensuring the safe operation of muffle furnaces, it prevents harmful substances from entering the air.	336	1	336	may	50/50%	Delivered
BR24993178	Laboratory table with two exhaust drawers	1250х650х800	for conducting experiments and organizing a workspace.	636	1	636	may	50/50%	Delivered
BR24993178	Laboratory fume hood with standard glass	1200х800х2200	to conduct experiments safely and ensure proper ventilation in the laboratory.	636	1	636	may	50/50%	Delivered
BR24993178	Island laboratory table	2 island tables, upper shelf, stainless steel sink table, drying rack	For conducting laboratory experiments.	386	1	386	may	50/50%	Delivered
BR24993178	Single-door closed cabinet	500х400х1900	For storage of laboratory equipment, reagents.	116	1	116	may	50/50%	Delivered

Барлығы: 9 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23486449	Laboratory services	Pathogenic including salmonella:kurt - 4800, protein precipitate of buttermilk – 4800; Listeria (L.monocytogenes): kurt - 12540, buttermilk protein precipitate – 12540; QMAFAnM: kurt - 2900, buttermilk protein precipitate – 2900; E. coli group bacteria (coliforms): kurt - 3000, protein residue of buttermilk – 3000; Yeast: kurt - 2700, buttermilk protein precipitate – 2700; Mold: kurt - 2800, protein precipitate of buttermilk – 2800; S.aureus: kurt - 3100, buttermilk protein precipitate – 3100; Determination of the viamine composition of the drug: A – 15000; E – 15000; D – 15000; C – 14500; B4 (choline) – 18800; Determination of the mineral composition of kurt: Calcium (Ca) – 9000; Magnesium (Mg) – 9000; Selenium (Se) – 9100; Protein: kurt – 12900, buttermilk protein precipitate – 12900; Fat: buttermilk – 10,500, protein residue of buttermilk – 10,500; Moisture: kurt – 3900, protein precipitate of buttermilk – 3900; Ash: kurt – 3900, buttermilk protein precipitate – 3900; Carbohydrates (counting method): kurt – 1000, protein residue of buttermilk – 1000; Mass fraction of table salt: kurt – 6300, protein precipitate of buttermilk – 6300.	For the implementation of Item 4 of the calendar plan for research and development.	239780	1	239780		100%	Delivered
АР23486449	Automated measuring system Laktan 700	Definable parameters (8 pcs.): fat, protein, dry matter, SOMO, density, lactose, added water, freezing point Measurement time: 1 minute and 30 seconds Types of milk: whole cow's milk (other types of milk are optional). to the order) Milk sample preparation: the ability to work with warm and cold milk Flushing: semi-automatic Connecting to a computer: via a USB port, Windows software is included. Connecting to a portable printer: Built-in printer Features: a special conveyor automates the process of preparation and delivery of analyzed samples	Pursuant to paragraph 8 of the calendar plan	2500000	1	2500000		50/50%	Delivered
АР23486449	Food product testing services	Product: Kurt from secondary dairy raw materials with plant additives. Organoleptic tests – 1. Toxicological tests: pesticides – 1, mycotoxins – 1, heavy metal salts – 1, antibiotics – 1. Radiological tests – 1.	Product: Kurt from secondary dairy raw materials with plant additives. Organoleptic tests – 1. Toxicological tests: pesticides – 1, mycotoxins – 1, heavy metal salts – 1, antibiotics – 1. Radiological tests – 1.	10390	1	10390		100%	Delivered
АР23486449	Buttermilk	Natural by-product of the dairy industry, rich in proteins and lactose. Quantity – 300 l.	Used in a scientific project	105	1	105		50/50%	Delivered
АР23486449	Dried whey	Contains milk proteins, lactose, and minerals, used in the food industry. Quantity – 50 kg.	Studied for its effects on digestion and use as a functional ingredient.	50	1	50		100%	Delivered
АР23486449	Soy concentrate	High-protein plant-based product, contains all essential amino acids. Quantity – 12 kg.	Used to study alternative protein sources in the food system.	60	1	60		100%	Delivered
АР23486449	Sea salt	Natural source of minerals, contains magnesium, potassium, and trace elements. Quantity – 10 kg.	Used to study the effect of mineral composition on product quality.	5	1	5		100%	Delivered
АР23486449	Milk	Natural source of proteins, fats, lactose, and calcium. Quantity – 800 l.	Used as the primary medium for studying dairy products. Total cost: 400,000 tenge	400	1	400		100%	Delivered
АР23486449	Flax seeds	Rich in omega-3 fatty acids, fiber, and antioxidants. Quantity – 7 kg.	Used to study the functional properties of food components.	21	1	21		100%	Delivered
АР23486449	AA-7000 spectrometer complete with Fe, Cd, Pd lamps	The spectral range is 185-900 nm. A three-dimensional two-beam optical circuit using a digital optical filter and elements that reduce radiation loss.	For research, for agriculture and food industry, for quality control, determination of heavy metals.	30	1	30	july	50/50%	Delivered
АР23486449	Laboratory services	Determination of fatty acid composition in 2 samples Determination of fat-soluble antioxidants in 1 sample Determination of water-soluble antioxidants in 1 sample	In pursuance of the calendar plan	70000	1	70000	may	100%	Delivered

Барлығы: 11 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status	Submit Commercial Proposal
АР23485656	Conceptualization, development of objects of an intelligent expert system for prediagnosis in medicine using neural networks	Conceptualization and development of objects of an intelligent expert system for prediagnosis in medicine using neural networks will be carried out.	Conceptualization, development of objects of an intelligent expert system for prediagnosis in medicine using neural networks	4000000	1	4000000		100%	Delivered
АР23485656	The MLS400 Residual Current Device	The MLS400 device features a multi-layer protection system that provides automatic disconnection in case of electric shock risk, short circuit, or ground leakage. It includes automatic insulation, grounding control, and self-monitoring capabilities. The unit is highly sensitive, reliable, and has a fast response time of no more than 0.2 milliseconds. The operating input voltage range is 150–264 V, and the output voltage is 220±4 V.	The MLS400 Residual Current Device is designed to protect people—primarily the operator—from electric shock due to direct or indirect contact with live electrical parts, and also to safeguard laboratory equipment and installations from fault currents and harmful electrical impacts.	1	1	1	may	50/50%	Delivered

Барлығы: 2 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
BR21882447	HANNA HI 99161 pH meter (portable).	HANNA HI 99161 pH meter (portable). pH range -2 : 16 pH temperature -5 : 105°C Resolution pH 0.01 pH temperature 0.1°C pH error ±0.02 pH temperature ± 0.5 °C to 60 °C; ± 1.0 °C outside ± 1.0 °F to 140 °F; ± 2.0 °F outside pH calibration is automatic, at one or two points with two sets of standard buffers (pH 4,01 / 7,01 / 10,01 or pH 4,01 / 6,86 / 9,18 ), established by Standard: 4.01; 7.01; 10.01 or NIST: 4.01; 6.86; 9.21 Thermal compensation Automatically from -5.0 to 105.0 °C pH FC2023 electrode Battery 3 x 1.5V AAA Battery life 1400 Operating conditions temperature 0 : 50°C humidity up to 100% Dimensions 154 x 63 x 30mm Weight 199g	For measuring pH and temperature in dairy and meat products. pH monitoring is crucial to ensure the quality of products.	990470	1	990470		50/50%	Delivered
BR21882447	Bowls for planetary ball mill	The volume is 500ml. For use in SQL 4 Ball Mill.	For planetary ball mill	559550	1	559550		50/50%	Delivered
BR21882447	Desiccator	The diameter of the container is 15-30 cm.	For slow drying at room temperature, storage of hygroscopic compounds, in gravimetric analysis, when it is important to prevent saturation of the studied substances with an indefinite amount of water from the air.	35000	1	35000		50/50%	Delivered
BR21882447	Texture analyzer "Structurometer ST-2" (RF)	Texture analyzer "Structurometer ST-2"	The texture analyzer “Structurometer ST-2” is designed to determine the rheological characteristics of raw materials, semi-finished products and finished products	14640000	1	14640000		50/50%	Delivered
BR21882447	SFA 06E Fat Analyzer	SFA 06E Fat Analyzer Technical characteristics of the SFA-06E fat analyzer • Sample weight, g — 0.5-20.0; • measuring range, % — 0.1-100.0; • solvent volume, ml — 500.0; • solvent extraction, % — not less than 85; • number of samples per batch — 6; • heating temperature, °C — room temperature +5 – 100; • dimensions, W×D×H, mm — 740×260×660; • weight, kg — 50.	The fat analyzer is widely used in the food and feed industries. It measures the fat content using the Soxlet extraction method, using extraction by heating and soaking, solvent regeneration and cooling	4740000	1	4740000		50/50%	Delivered
BR21882447	Registration of a patent for a utility model (2 pcs.)	Identification of signs of inventions or utility models in research materials on the topic. Conducting a patent search through the collections of patent and scientific and technical documentation to identify analogues and prototypes. Registration of application documents for obtaining a patent of the Republic of Kazakhstan for an invention or utility model	Scientific and technical task №. 103 on program-targeted financing of administrators of budget programs for 2024-2026	100000	1	100000		100%	Delivered
BR21882447	Radiation treatment service at ELV-4 and ILU-10 accelerators	The total amount of radiation treatment services is 2 hours. The radiation dose is 3 kg, 6 kg, 9 kg. The name of the studied samples: beef meat, barley, wheat, bran, mixed feed.	For the implementation of paragraph 4.1 of the calendar plan for research and development.	111800	1	111800		100%	Delivered
BR21882447	raw material	Turkey meat 25 kg - 2500 tg; Beef meat 30 kg - 3500 tg; Lamb meat 25 kg - 3000 tg; Horse meat 25 kg - 3500 tg; Dried fruits 10 kg - 5000 tg; Dry herbs 5 kg - 4000 tg; Fish 15 kg - 4,500 tg Seafood 15 kg - 5500 tg; Spices 5 kg - 5000 tg; Seasonings 5 kg - 5000 tg; Compound feed 10 kg - 500 tg.	For laboratory work	605000	1	605000		100%	Delivered
BR21882447	Laboratory services	Determination of the mass fraction of protein, amino acid content (arginine, lysine, tyrosine, phenylalanine, histidine, leucine+isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine), determination of fat acidity, determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc), quantitative determination of iron, zinc, pestecides, determination of QMAFAnM, determination of mold)	For the implementation of paragraph 4.1 of the calendar plan for research and development.	692000	1	692000		100%	Delivered
BR21882447	Laboratory services	Determination of mycotoxins	For the implementation of paragraph 4.1 of the calendar plan for research and development.	82000	1	82000		100%	Delivered
BR21882447	IT infrastructure maintenance and technical support services	Разработка и применение цифровой технологии в комплексной системе «поле – обработка – хранение – переработка – готовая продукция» по повышению количественно-качественной сохранности и безопасности сельскохозяйственного сырья и продуктов его переработки	Бағдарламаның күнтізбелік жоспарының тармақтарын орындау мақсатында	4000000	1	4000000		50/50%	Delivered
BR21882447	Radiation treatment service at ELV-4 and ILU-10 accelerators.	The total amount of radiation treatment services is 2 hours. The radiation dose is 3 kg, 6 kg, 9 kg. The name of the studied samples: beef meat, barley, wheat, bran, mixed feed.	For the implementation of paragraph 4.1 of the calendar plan for research and development.	300000	1	300000	april	100%	Delivered
BR21882447	Monograph publication	Monograph Title: Development of a Food Safety System for Long-Term Storage Based on Electrophysical and Radiation Processing Methods Authors: D.R. Orynbekov, K.Zh. Amirkhanov, B.K. Asenova, Zh. Kalibekkyzy, A.N. Nurgazezova, G.N. Nurymkhan, N.R. Muslimova At present, ensuring the safety of food products and extending their shelf life are issues of global significance. The increase in microbiological contamination of food, challenges in transportation and storage conditions, as well as growing consumer demand for high-quality and safe products, all require the introduction of new technologies. In this context, electrophysical and radiation processing methods are considered scientifically and technologically grounded, effective approaches for preserving the freshness of food products—particularly meat and meat products—for extended periods. This monograph presents the theoretical foundations of electrophysical and radiation processing, the mechanisms of physicochemical impact, their effect on microbiological safety, and the results of specific experimental studies. In particular, scientifically based recommendations are provided for enhancing product safety and extending shelf life through treatment using low-energy electron irradiation.	In fulfillment of the points of the program's calendar plan."	520	1	520	Мау	50/50%	Delivered

Барлығы: 13 plan

For better viewing of the table, rotate your device or scroll horizontally.

IIN	Name	Description	Equipment Purchase Justification	Planned Cost	Quantity	Amount	Purchase Deadlines	Payment Terms	Status
АР23484846	laptop	Operating system - Windows 10 Home; Operating system architecture - 64-bit; Updatable Windows OS - yes; Processor manufacturer - Intel Core i5; Processor frequency - 3 GHz; Processor core - Six-core (6 cores); Total installed system memory of at least 8 GB; Total capacity of solid-state drives of at least 512 GB; Screen resolution 1920 x 1080; Standard refresh rate - 144 Hz; Maximum battery life - 10 hours, preferably gray	To perform work remotely	485749	1	485749		50/50%	Delivered
АР23484846	Dumpling machine	Dumpling machine. Technical characteristics of the dumpling machine Capacity, pcs / h 3600 Weight of the dumpling- depends on the setting Power consumption 2.5 kw Overall dimensions, mm 640 x 440 x 810 Weight, not more than kg 100	Designed for automatic molding of dumplings from available ingredients	1430500	1	1430500		50/50%	Delivered
АР23484846	The cutlet shaper is automatic.	Power: 0.55 kW Container capacity: 32 L Voltage: 380V, 50 Hz Size: 8506001400 mm Weight: not more than 100 kg Capacity: no more than 2100 pcs/hour	Table-top automatic cutlet shaper for forming cutlets up to 100 mm in diameter	2927900	1	2927900		50/50%	Delivered
АР23484846	Spiral dough mixer 60l.	Power: 2.2 kW Mixing speed: 125/250 rpm Voltage: 220V/380V/50Hz Size: 880530920 mm Weight: up to 180 kg Capacity: approximately 22-25 kg Bowl capacity: 60 L	To minimize the cooking time of the dough kneading.	2088656	1	2088656		50/50%	Delivered
АР23484846	Horse meat	Horse meat of the highest grade in accordance with GOST 27095. Quantity – 80 kg.	Conducting laboratory work in accordance with the calendar plan	3700	80	296000		100%	Delivered
АР23484846	Turkey meat	Dietary product, low-fat content, high in protein and selenium. Quantity – 20 kg.	Included in the research to analyze its effects on protein metabolism and digestion.	2400	20	48000		100%	Delivered
АР23484846	Chicken meat	Easily digestible protein source, rich in vitamins B6 and B12, suitable for various dietary studies. Quantity – 20 kg.	Used to study its impact on protein absorption and energy metabolism in the body.	2000	20	40000		100%	Delivered
АР23484846	Beef	Rich in iron, protein, and amino acids, supports muscle mass formation. Quantity – 80 kg.	Used to analyze nutritional value and amino acid metabolism effects.	4000	80	320000		100%	Delivered
АР23484846	Lamb	High nutritional value, contains omega-3 fatty acids and antioxidants. Quantity – 80 kg.	Studied within the project to evaluate its effects on lipid metabolism and digestion.	3700	80	296000		100%	Delivered
АР23484846	Sheep tail fat	Natural fat source, rich in unsaturated fatty acids. Quantity – 40 kg.	Studied to assess its effects on fat metabolism and absorption.	4000	40	160000		100%	Delivered
АР23484846	Green buckwheat	Rich in antioxidants, fiber, and plant-based protein. Quantity – 40 kg.	Used to study its effects on blood sugar levels and digestive processes.	48	1	48		100%	Delivered
АР23484846	Wheat flour	Source of carbohydrates, contains B vitamins and fiber. Quantity – 40 kg.	Studied for its impact on glycemic levels and metabolic processes.	14	1	14		100%	Delivered
АР23484846	Food product analysis	Characteristics and justification for purchasing services to analyze 7 food samples (meat and meat products) within the scientific project: Water Activity (Aw) Required to evaluate the microbiological stability and shelf-life of meat products. Water activity determines the potential risk of microbial growth and spoilage, affecting product safety and quality. Acidity (pH) A critical parameter determining the quality of meat and meat products, including texture, color, microbiological safety, and the rate of product maturation. Moisture Holding Capacity (MHC) Important for assessing the quality of raw materials and finished products, as it directly affects the texture, juiciness, and technological characteristics of meat products, influencing consumer appeal and production technology parameters. Water Binding Capacity (WBC) A key indicator affecting moisture retention during technological processing, directly influencing the yield and economic efficiency of finished products. Fat Holding Capacity (FHC) Affects the ability of raw meat materials and finished products to retain fats, which is critical for organoleptic properties, stability, and overall product quality.	Conducting these analyses is necessary for the implementation of a scientific project studying the functional-technological properties of meat raw materials and products derived from them. The obtained results will enable the development of scientifically-based recommendations for optimizing recipes and production technologies of meat products, enhancing their safety, quality, and competitiveness in the market.	94500	1	94500		100%	Delivered
АР23484846	Food Research	Within the framework of the scientific project, 8 samples of meat and meat semi-finished products will be investigated for: Determination of amino acid composition (arginine, lysine, tyrosine, phenylalanine, histidine, leucine+isoleucine, methionine, valine, proline, threonine, serine, alanine, glycine) 1 by Capillary Electrophoresis, Determination of fatty acid composition by Gas Chromatography (GC), Determination of the amount of B vitamins (B1, B2, B3, B5, B6, Bc) by Capillary Electrophoresis, Determination of the amount of Vitamin C, Determination of iron, Determination of magnesium, Determination of calcium, Determination of iodine, Determination of lead, Determination of arsenic, Determination of potassium-40, Determination of cesium-137, Determination of TAMC (Total Aerobic and Facultative Anaerobic Microorganisms), Determination of BGKP (coliforms), Determination of pathogenic bacteria, including Salmonella, Determination of L. monocytogenes, Determination of sulfite-reducing clostridia.	The laboratory tests in question are a necessary stage of the scientific work, providing objective data on the quality and safety of radiation-processed meat semi-finished products. The results will be used for scientific reporting and the preparation of publications.	527600	1	527600	april	50/50%	Delivered

Барлығы: 14 plan

Notice

Science Procurement